= Solution
One candidate inward-facing <PCR primer> pair, written $5'$ to $3'$, is
$$
\begin{aligned}
F&:\quad\mathrm{TGCCCTCTATTCACAGATAAC},\\
R&:\quad\mathrm{AGCTTCCATCTGAAGAGGGT}.
\end{aligned}
$$
The forward <PCR primer> binds the intronic flank immediately upstream of exon 5; the reverse <PCR primer> is the <reverse complement> of a downstream exon-5 segment. \b[Their <amplicon> includes the repeat while both binding sites lie outside it.] Using the displayed reference sequence gives an approximately $122$-base-pair product; an <indel> changes the intervening length and sequence. The primers have matched simple Wallace-rule estimates near $60\,{}^\circ\mathrm C$. These are candidates from the supplied sequence: confirm genomic specificity, absence of variable primer-binding sites, secondary structures and actual reaction conditions before use. Sequence from a unique flank toward the repeat and verify a single specific product.
Back to article page
