= Solution
A practical design uses one common exon-4 forward <PCR primer> with an exon-specific reverse <PCR primer> for each <transcript isoform>. Candidate sequences, all written $5'$ to $3'$, are
$$
\begin{aligned}
F_4&:\quad\mathrm{GCGCTTTGGCCTTGATCAAC},\\
R_5&:\quad\mathrm{AGCTTCCATCTGAAGAGGGT},\\
R_6&:\quad\mathrm{CTTGTATGTAGCGAACTCCG}.
\end{aligned}
$$
Use \b[$F_4/R_5$ for TCF-long and $F_4/R_6$ for TCF-short]: $R_5$ recognizes exon 5, while $R_6$ recognizes exon 6. The displayed mature reference sequences predict approximately $130$- and $67$-base-pair products, respectively. Check actual splice products because a transcript with unexpected exon combinations could defeat the assumed specificity. The simple melting-temperature estimates are approximately $62$, $60$ and $60\,{}^\circ\mathrm C$.
Prepare matched <RNA>, remove contaminating <DNA>, carry out <reverse transcription> and validate each <RT-qPCR> assay with known isoform standards, a single-product check, a no-template control and a no-reverse-transcriptase control. The primers span an <intron> in the genomic arrangement but do not themselves cross a <splice junction>, so the DNA control remains important. \b[Calibrate amplification efficiency and fluorescence response before comparing molecule numbers between the two assays.] A redesigned junction-specific assay is another option once additional suitable flanking sequence is available.
Back to article page
