Unsupervised learning Updated +Created
Bootloader Updated +Created
Compiled vs interpreted programming language Updated +Created
Tangent vector to a manifold Updated +Created
Zhuang Zhou Updated +Created
Redistribution of wealth Updated +Created
Hidden surprises in the Bitcoin blockchain by Ken Shirriff (2014) Updated +Created
Ken Shirriff is a cool dude, he's done some collabs with Marc Verdiell in electronics restoration.
Semi-boring academic overview, but without reproducibility, or in a way that is too hidden for Ciro to have the patience to find it out.
Claims 1600 files found.
Mentions some upload mechanisms, notably AtomSea & EMBII and Satoshi uploader.
Military technology Updated +Created
Milky Way Updated +Created
Ciro Santilli's Stack Overflow suspension for vote fraud script 2019 Updated +Created
After Ciro Santilli got a lot of attention on Hacker News news.ycombinator.com/item?id=19428700 his Stack Overflow account was suspended for 3 days web.archive.org/web/20190320163458/https://stackoverflow.com/users/895245/ciro-santilli-新疆改造中心-六四事件-法轮功 and he received a magic notification that led to a private message:
Hello,
I'm writing in reference to your Stack Overflow account:
I don't understand why you are actively promoting and assisting people to commit fraud on the site.
I've removed this from your profile github.com/cirosantilli/stack-overflow-vote-fraud-script and do not expect you to post it around the site.
I'm suspending you to gain your attention on this matter.
We have temporarily suspended your account; you may return after 3 days.
Regards,
Stack Overflow Moderation Team
To: Aaron Hall ♦;Andy ♦;Baum mit Augen ♦;Bhargav Rao ♦;Bohemian ♦;BoltClock ♦;Brad Larson ♦;ChrisF ♦;Cody Gray ♦;deceze ♦;Ed Cottrell ♦;Flexo ♦;George Stocker ♦;Jean-François Fabre ♦;Jon Clements ♦;josliber ♦;Madara Uchiha ♦;Martijn Pieters ♦;meagar ♦;Michael Myers ♦;Rob ♦;Robert Harvey ♦;Ry- ♦;Samuel Liew ♦;Undo ♦;Yvette Colomb ♦
Ciro's reply was:
Hi mods,
Reply and unsuspend quickly followed, with link still removed:
I suspended you to get your attention. Your attitude about going to Twitter about it does not bode well with me.
Feel free to have whatever you want in your GitHub repo. Just don't advertise tools to make it easier for people to circumvent the rules. As easy or as hard as it may be to circumvent them, you're handing it to people who may not be capable of doing so. It doesn't help.
Don't make threats to upload on an anonymous account. Accounts created to circumvent previous warnings are not welcomed on the site.
We don't need a meta thread to discuss whether it's ok to post voting fraud links in your profile and we definitely don't need to give it anymore publicity.
I'll unsuspend you, now we've had this discussion.
Regards,
Stack Overflow Moderation Team
A meta thread was later created by Yvette, kudos, to which Ciro answered with the correct unpopular answer that will be downvoted to oblivion: meta.stackoverflow.com/questions/381577/is-it-ok-to-have-links-on-how-to-create-sock-puppets-and-gain-rep-fraudulently-i/381635#381635
Yvette had also previously deleted one or two of Ciro's answers for being duplicates, which is a policy Ciro is against: if the questions are not dupes, a single answer might still directly reply to both of them.
Yvette later announced that she was leaving the website: meta.stackoverflow.com/questions/399495/leaving-the-site-and-the-network-mid-election-is-not-the-best-but-theres-no. This is evil, but Ciro was happy. He does not mean harm to Yvette, but in their limited interaction, Ciro disagreed with her choices.
Video 1.
The Great Places Erased by Suburbia by Not Just Bikes (2022)
Source. Stack Overflow, and other online forums, can serve as a sort of a third place for its more active users.
Eightfold way (physics) Updated +Created
Video 1.
Strangeness Minus Three (BBC Horizon 1964)
Source. Basically shows Richard Feynman 15 minutes on a blackboard explaining the experimental basis of the eightfold way really well, while at the same time hyperactively moving all over. The word symmetry gets tossed a few times.
Compiler Updated +Created
E. Coli K-12 MG1655 Updated +Created
NCBI taxonomy entry: www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=511145 This links to:
  • genome: www.ncbi.nlm.nih.gov/genome/?term=txid511145 From there there are links to either:
    • Download the FASTA: "Download sequences in FASTA format for genome, protein"
      For the genome, you get a compressed FASTA file with extension .fna called GCF_000005845.2_ASM584v2_genomic.fna that starts with:
      >NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome
      AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG
      Using wc as in wc GCF_000005845.2_ASM584v2_genomic.fna gives 58022 lines, in Vim we see that each line is 80 characters, except for the final one which is 52. So we have 58020 * 80 + 52 = 4641652 =~ 4.6 Mbp
Los Angeles Updated +Created
Genetic diversity Updated +Created
Composition series Updated +Created
Organized crime Updated +Created
Complexity class Updated +Created

Unlisted articles are being shown, click here to show only listed articles.