But as Scott's fame for giving away money has grown, so too has the deluge of appeals for gifts from strangers and old friends alike. That clamour may have driven Scott's already discreet operation further underground, with recent philanthropic announcements akin to sudden lightning bolts for unsuspecting recipients.
Microwave technology was developed in World War II for radar, notably at the MIT Radiation Laboratory. Before that, people were using much higher frequencies such as the visible spectrum. But to detect small energy differences, you need to look into longer wavelengths.
This experiment was fundamental to the development of quantum electrodynamics. As mentioned at Genius: Richard Feynman and Modern Physics by James Gleick (1994) chapter "Shrinking the infinities", before the experiment, people already knew that trying to add electromagnetism to the Dirac equation led to infinities using previous methods, and something needed to change urgently. However for the first time now the theorists had one precise number to try and hack their formulas to reach, not just a philosophical debate about infinities, and this led to major breakthroughs. The same book also describes the experiment briefly as:
Willis Lamb had just shined a beam of microwaves onto a hot wisp of hydrogen blowing from an oven.
Has some good mentions, but often leaves you wanting more details of how certain things happened, especially the early days stuff.
Does however paint a good picture of several notable employees, and non-search projects from the early 2000's including:
the cook dude
porn cookie guy
the unusual IPO process
Paints a very positive picture of the founders. It is likely true. They gave shares generously to early employees. Tried to allow the more general public to buy from IPO, by using a bidding scheme, rather than focusing on the big bankers as was usual.
Two of the most compelling areas that Google and its founders are quietly working on are the promising fields of molecular biology and genetics. Millions of genes in combination with massive amounts of biological and scientific data are an excellent match for the Google search engine, the tremendous database the company has in place, and its immense computing power. Already, Google has downloaded a map of the human genome and is working closely with biologist Dr. Craig Venter and other leaders in genetics on scientific projects that may lead to important breakthroughs in science, medicine, and health. In other words, we may be heading toward a time when people can google their own genes.
The book gives good highlight as to why Google became big: search was just an incredibly computationally intensive task. From very early days, Largey were already making up their own somewhat custom compute systems from very early days, which naturally led into Google custom hardware later on. Google just managed to pull ahead on the reinvest revenue into hardware loop, and no one ever caught them back. This feels more the case than e.g. with Amazon, which notoriously had to buy off dozens of competitors to clear the way.
If the number of sections is greater than or equal to SHN_LORESERVE (0xff00), e_shnum has the value SHN_UNDEF (0) and the actual number of section header table entries is contained in the sh_size field of the section header at index 0 (otherwise, the sh_size member of the initial entry contains 0).
There are also other magic sections detailed in Figure 4-7: Special Section Indexes.
System V ABI 4.1 (1997) www.sco.com/developers/devspecs/gabi41.pdf, no 64 bit, although a magic number is reserved for it. Same for core files. This is the first document you should look at when searching for information.
It would be boring if we could only simulate the same condition all the time, so let's have a look at the different boundary conditions that we can apply to the cell!
We are able to alter things like the composition of the external medium, and the genome of the bacteria, which will make the bacteria behave differently.
The variant selection is a bit cumbersome as we have to use indexes instead of names, but one you know what you are doing, it is fine.
Of course, genetic modification is limited only to experimentally known protein interactions due to the intractability of computational protein folding and computational chemistry in general, solving those would bsai.
Download the FASTA: "Download sequences in FASTA format for genome, protein"
For the genome, you get a compressed FASTA file with extension .fna called GCF_000005845.2_ASM584v2_genomic.fna that starts with:
>NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG
Using wc as in wc GCF_000005845.2_ASM584v2_genomic.fna gives 58022 lines, in Vim we see that each line is 80 characters, except for the final one which is 52. So we have 58020 * 80 + 52 = 4641652 =~ 4.6 Mbp
Ciro Santilli 34 Updated 2024-12-15 +Created 1970-01-01