E. Coli K-12 MG1655 Updated +Created
NCBI taxonomy entry: www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=511145 This links to:
  • genome: www.ncbi.nlm.nih.gov/genome/?term=txid511145 From there there are links to either:
    • Download the FASTA: "Download sequences in FASTA format for genome, protein"
      For the genome, you get a compressed FASTA file with extension .fna called GCF_000005845.2_ASM584v2_genomic.fna that starts with:
      >NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome
      AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG
      Using wc as in wc GCF_000005845.2_ASM584v2_genomic.fna gives 58022 lines, in Vim we see that each line is 80 characters, except for the final one which is 52. So we have 58020 * 80 + 52 = 4641652 =~ 4.6 Mbp
Escherichia coli Updated +Created
Size: 1-2 micrometers long and about 0.25 micrometer in diameter, so: 2 * 0.5 * 0.5 * 10e-18 and thus 0.5 micrometer square.
Reference strain: E. Coli K-12 MG1655.
Genome:
  • 4k genes
  • 5 Mbps
  • www.ncbi.nlm.nih.gov/genome/167
  • wget ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/005/845/GCF_000005845.2_ASM584v2/GCF_000005845.2_ASM584v2_genomic.fna.gz
  • wget -O NC_000913.3.fasta 'https://www.ncbi.nlm.nih.gov/search/api/sequence/NC_000913.3/?report=fasta'
Omics modeling: www.ncbi.nlm.nih.gov/pmc/articles/PMC5611438/ Tools for Genomic and Transcriptomic Analysis of Microbes at Single-Cell Level Zixi Chen, Lei Chen, Weiwen Zhang.
Genomics Updated +Created
Study of the genome, one of the omics.