Ciro Santilli @cirosantilli 34

 Incoming links: BioCyc promoter database

BioCyc  Updated 2024-12-15  +Created 1970-01-01

Very good metabolism database.

Some things that they have of interest which may not be on NCBI:

BioCyc promoter database

Hits a free login wall after a few IP hits. And just a very normal casually browsing number of hits. What is this bullshit?

Their YouTube: www.youtube.com/channel/UCR9QDQ_9_N4isZV_YRQg9tA has some good tutorials.

 Read the full article

E. Coli K-12 MG1655  Updated 2024-12-15  +Created 1970-01-01

 View more

NCBI taxonomy entry: www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=511145 This links to:

genome: www.ncbi.nlm.nih.gov/genome/?term=txid511145 From there there are links to either:
- Download the FASTA: "Download sequences in FASTA format for genome, protein"
  For the genome, you get a compressed FASTA file with extension .fna called GCF_000005845.2_ASM584v2_genomic.fna that starts with:
  >NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG
  Using wc as in wc GCF_000005845.2_ASM584v2_genomic.fna gives 58022 lines, in Vim we see that each line is 80 characters, except for the final one which is 52. So we have 58020 * 80 + 52 = 4641652 =~ 4.6 Mbp
- Interactively browse the sequence on the browser viewer: "Reference genome: Escherichia coli str. K-12 substr. MG1655" which eventually leads to: www.ncbi.nlm.nih.gov/nuccore/556503834?report=graph
  If we zoom into the start, we hover over the very first gene/protein: the famous (just kidding) e. Coli K-12 MG1655 gene thrL, at position 190-255.
  The second one is the much more interesting e. Coli K-12 MG1655 gene thrA.
- Gene list, with a total of 4,629 as of 2021: www.ncbi.nlm.nih.gov/gene/?term=txid511145

KEGG entry: www.genome.jp/pathway/eco01100+M00022

BioCyc promoter database query URL: biocyc.org/group?id=:ALL-PROMOTERS&orgid=ECOLI

 Read the full article

E. Coli K-12 MG1655 operon thrLABC  Updated 2024-12-15  +Created 1970-01-01

 View more

Contains the genes: e. Coli K-12 MG1655 gene thrL, e. Coli K-12 MG1655 gene thrA, e. Coli K-12 MG1655 gene thrB and e. Coli K-12 MG1655 gene thrC, all of which have directly linked functionality.

We can find it by searching for the species in the BioCyc promoter database. This leads to: biocyc.org/group?id=:ALL-PROMOTERS&orgid=ECOLI.

By finding the first operon by position we reach: biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486.

That page lists several components of the promoter, which we should try to understand!

Some of the transcription factors are proteins:

After the first gene in the codon, thrL, there is a rho-independent termination. By comparing:

we understand that the presence of threonine or isoleucine variants, L-threonyl and L-isoleucyl, makes the rho-independent termination become more efficient, so the control loop is quite direct! Not sure why it cares about isoleucine as well though.

TODO which factor is actually specific to that DNA region?

 Read the full article