NCBI taxonomy entry: www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=511145 This links to:
- genome: www.ncbi.nlm.nih.gov/genome/?term=txid511145 From there there are links to either:
- Download the FASTA: "Download sequences in FASTA format for genome, protein"For the genome, you get a compressed FASTA file with extension
.fnacalledGCF_000005845.2_ASM584v2_genomic.fnathat starts with:>NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG
- Interactively browse the sequence on the browser viewer: "Reference genome: Escherichia coli str. K-12 substr. MG1655" which eventually leads to: www.ncbi.nlm.nih.gov/nuccore/556503834?report=graphIf we zoom into the start, we hover over the very first gene/protein: the famous (just kidding) e. Coli K-12 MG1655 gene thrL, at position 190-255.The second one is the much more interesting e. Coli K-12 MG1655 gene thrA.
- Gene list, with a total of 4,629 as of 2021: www.ncbi.nlm.nih.gov/gene/?term=txid511145
For specific species:
Capital of the Northern Song dynasty. Features in Water Margin.
Ciro Santilli lived there from 1995 to 1997.
Tabla Solo in Jhaptal by Alla Rakha, featuring Ravi Shankar (2003)
Source. 
Superconductivity is one of the key advances of 21st century technology:
- produce powerful magnetic fields with superconducting magnets
- the Josephson effect, applications listed at: Section "Applications of Josephson Junctions"
Big collection of a bunch of ghost stories. 90% of them involve some dude dating a beautiful ghost woman or animal that can shapeshift as a woman.
Organized into 12 chapeters as seen on the Chinese wiki: zh.wikipedia.org/wiki/聊齋志異#章節
1935 edition of Strange Tales from a Chinese Studio
. Source. 
Main theory to explain Type I superconductors very successfully.
TODO can someone please just give the final predictions of BCS, and how they compare to experiments, first of all? Then derive them.
High level concepts:
- the wave functions of pairs of electrons (fermions) get together to form bosons. This is a phase transition effect, thus the specific sudden transition temperature.
- the pairs form a Bose-Einstein condensate
- once this new state is reached, all pairs are somehow entangled into one big wave function, and you so individual lattice imperfections can't move just one single electron off trajectory and make it lose energy
Unlisted articles are being shown, click here to show only listed articles.