This is an extremely widely used technique as of 2020 and much earlier.
If allows you to amplify "any" sequence of choice (TODO length limitations) between a start and end sequences of interest which you synthesize.
If the sequence of interest is present, it gets amplified exponentially, and you end up with a bunch of DNA at the end.
You can then measure the DNA concentration based on simple light refraction methods to see if there is a lot of DNA or not in the post-processed sample.
One common problem that happens with PCR if you don't design your primers right is: en.wikipedia.org/wiki/Primer_dimer
Sometime it fails: www.reddit.com/r/molecularbiology/comments/1kouomw/when_your_pcr_fails_again_and_you_start/
Nothing humbles you faster than a bandless gel. One minute you’re a scientist, the next you’re just a pipette-wielding wizard casting spells that don’t work. Meanwhile, physicists are out there acting like gravity always behaves. Smash that upvote if your reagents have ever gaslit you.
and a comment:
PCR = Pray, Cry, Repeat
Also known as: Quantitative PCR (qPCR).
Like PCR, but the amplification machine measures the concentration of DNA at each step.
This describes one possible concentration detection method with fluorescent molecules that only become fluorescent when the DNA is double stranded (SYBR Green)
Video 1.
Polymerase Chain Reaction (PCR) - Quantitative PCR (qPCR) by Applied Biological Materials (2016)
Source.
This allows you to predict the exact initial concentration by extrapolating the exponential curve backwards.
TODO: vs non-real-time PCR. Why can't you just divide by 2 for every heating step to reach back the original concentration? Likely the reaction reach saturation at an unknown step.
TODO: vs non-real-time PCR in medical diagnostics: do you really need to know concentration for diagnostics? Isn't it enough to know if the virus is present or not?
Isothermal means "at fixed temperature".
This is to contrast with the more well established polymerase chain reaction, which requires heating and cooling the sample several times.
The obvious advantage of isothermal methods is that their machinery can be simpler and cheaper, and the process can happen faster, since you don't have to do through heating and cooling cycles.
Like PCR, but does not require thermal cycling. Thus the "isothermal" in the name: iso means same, so "same temperature".
Not needing the thermo cycling means that the equipment needed is much smaller and cheaper it seems.
Video 1.
Loop Mediated Isothermal Amplification (LAMP) Tutorial by New England Biolabs (2015)
Source. Explains the basic LAMP concept well.

Articles by others on the same topic (2)

Polymerase chain reaction by M. M. Hryc 0 Created 2024-02-20 Updated 2025-04-18
The aim of PCR is to quickly amplify a specific region of a DNA sequence — in
other words to make more copies of it.
Rudimentary explanation of the basis of the method is as follows:
Single strand of DNA (single stranded DNA, ssDNA) constitutes of a backbone
chain and 4 different nitrogen bases (coded as A,T,C,G) that are attached to
the chain in a uniform way. Their arangement is the sequence or information (in
a loose sense) that a strand of DNA holds. The backbone chain has two ends that
are denoted as 5' and 3', unless stated otherwise a DNA sequence is always
expressed looking from the 5' end to the 3' end. For example:
5'—ACTGCTAGCGATCGATCGTAGCGTAGCGTATGCTGATCG—3'
The geometry and complementary electric charges of nitrogen bases allows for
stable eletrostatic attraction between A and T, and C and G, but not between A
and C or T and G. That is, the possible electrostatic bonding pairs are only AT
and CG. This fact, and other not mentioned qualities of DNA geometry allows two
strands of DNA with complementary sequences to allign themselves and form a
double stranded DNA (dsDNA) helical structure that is more stable and has lower
energy — it is a thermodynamically preffered state.
A simple model of two alligned strands of DNA with complementary sequences:
5'—ACTGCTAGCGATCGATCGTAGCGTAGCGTATGCTGATCG—3'
3'—TGACGATCGCTAGCTAGCATCGCATCGCATACGACTAGC—5'
The length of DNA sequences is expressed in nucleotides (nt) or base pairs (bp)
which is numerically equal to the lenght of the sequene expressed with letters
ATCG. The above dsDNA fragment is 39 nt or 39 bp long. Notice that strands are
anti–paralel — their ends are inverted, their sequences go in opposite
directions.
(1) The 1st step of PCR is denaturation: solution of your template DNA is
heated up to 98 °C, which raises the energy to the point where the
electrostatic attraction between nitrogen bases is not strong enough to
withstand the vibration of molecules, and the two strands separate.
(2) The 2nd step of PCR is annealing: the temperature is lowered to 58—68 °C.
Long strands of DNA in solution are disorganized and will not be able to fully
reform the helical structure on thier whole lenght. Two short (18—25 nt) ssDNA
called primers, that are complementary to the regions flanking the sequence of
interest in the template, form a short dsDNA segment with the template. The
lenght of 18—25 nt allows for greater mobility due to small size, but enough
sequence specifity to bind only with a single place in the template. A simple
representation of the end result:
5'—ACTGC—3'
3'—TGACGATCGCTAGCTAGCATCGCATCGCATACGACTAGC—5'
(the primer is shorter for easier representation, and there is only one strand
of the template shown, because non–monospace font makes it impossible to align
the other one properly, but the process for the other one is identical)
(3) The 3rd step of PCR is elongation: the temperature is raised to 72 °C,
which is optimal value for polymerase activity. Polymerase in an enzyme that
catalyses the synthesises of a new DNA strand. The specific kind used in PCR
synthesises does so by attaching appropriate building blocks to the 3' end of a
DNA strand using the complementary strand as a template, like this:
5'—ACTGC—3' —>
3'—TGACGATCGCTAGCTAGCATCGCATCGCATACGACTAGC—5'
...
5'—ACTGCTAGCGATCGATCGTAGCGTAGCGTATGCTGATCG—3'
3'—TGACGATCGCTAGCTAGCATCGCATCGCATACGACTAGC—5'
The same process takes place on both DNA strands of the template moleculea
single PCR cycle resulted in double the amount of copies of a desired sequence.
The proces is repeated (usually about 30 times) to exponentially increase the
number of copies up to copies, where is the starting
number of copies and is the number of cycles.
—additional notes—
a) annealing temperature is fitted to the primers used, which is based on their
lenght and sequence (usually calculated by some variation of the Nearest
Neigbour method);
b) first PCRs were carried out using non-thermostable polymerases, that became
denaturated and lost their enzymatic activity after each denaturation, and had
to be manually added before each elongation. Modern PCRs use thermostable
polymerases that are able to withstand high temperatures and sustain their
enzymatic activity;
Polymerase Chain Reaction (PCR) is a widely used molecular biology technique that allows for the amplification of specific segments of DNA. Developed in 1983 by Kary Mullis, PCR enables researchers to produce millions to billions of copies of a targeted DNA sequence from a small initial sample, making it easier to study and analyze that specific region of DNA.