Ciro Santilli's Stack Overflow suspension for vote fraud script 2019 Updated 2025-03-28 +Created 1970-01-01
After Ciro Santilli got a lot of attention on Hacker News news.ycombinator.com/item?id=19428700 his Stack Overflow account was suspended for 3 days web.archive.org/web/20190320163458/https://stackoverflow.com/users/895245/ciro-santilli-新疆改造中心-六四事件-法轮功 and he received a magic notification that led to a private message:
Hello,I'm writing in reference to your Stack Overflow account:I don't understand why you are actively promoting and assisting people to commit fraud on the site.I've removed this from your profile github.com/cirosantilli/stack-overflow-vote-fraud-script and do not expect you to post it around the site.I'm suspending you to gain your attention on this matter.We have temporarily suspended your account; you may return after 3 days.Regards,Stack Overflow Moderation TeamTo: Aaron Hall ♦;Andy ♦;Baum mit Augen ♦;Bhargav Rao ♦;Bohemian ♦;BoltClock ♦;Brad Larson ♦;ChrisF ♦;Cody Gray ♦;deceze ♦;Ed Cottrell ♦;Flexo ♦;George Stocker ♦;Jean-François Fabre ♦;Jon Clements ♦;josliber ♦;Madara Uchiha ♦;Martijn Pieters ♦;meagar ♦;Michael Myers ♦;Rob ♦;Robert Harvey ♦;Ry- ♦;Samuel Liew ♦;Undo ♦;Yvette Colomb ♦
Ciro's reply was:
Hi mods,
Security by obscurity does not work. If that is all Stack Overflow relies on, and that is what it looks like, then it is guaranteed to be flawed and already been attacked.That is one of the reasons that my website will eventually beat Stack Overflow: github.com/cirosantilli/write-free-science-books-to-get-famous-website/tree/d77b18d2e7acb3558615797c36195f60dfd26306#pagerank-with-tags If you had messaged me and told me "take down or suspend" I would have done it immediately because I understand the meaning of political power.That would have been the better course of action for everyone: I get no block, and you get no bad publicity as I shout Kerckhoff's principle on Twitter.But maybe it is a good thing that people learn more about that. Is there an existing public discussion saying that you cannot advertise vote fraud tools on this website?If not, can you please create that meta thread as a reference for future users, and perhaps let the community decide by itself?In particular, will you still suspend me if I don't take down the GitHub repo?Because if not, does it make any sense to prevent it from being mentioned in Stack Overflow? Any good GitHub repo just gets enough Google pagerank that it won't matter.And if yes, nothing prevents me from re-uploading on an anonymous account.
Reply and unsuspend quickly followed, with link still removed:
I suspended you to get your attention. Your attitude about going to Twitter about it does not bode well with me.Feel free to have whatever you want in your GitHub repo. Just don't advertise tools to make it easier for people to circumvent the rules. As easy or as hard as it may be to circumvent them, you're handing it to people who may not be capable of doing so. It doesn't help.Don't make threats to upload on an anonymous account. Accounts created to circumvent previous warnings are not welcomed on the site.We don't need a meta thread to discuss whether it's ok to post voting fraud links in your profile and we definitely don't need to give it anymore publicity.I'll unsuspend you, now we've had this discussion.Regards,Stack Overflow Moderation Team
A meta thread was later created by Yvette, kudos, to which Ciro answered with the correct unpopular answer that will be downvoted to oblivion: meta.stackoverflow.com/questions/381577/is-it-ok-to-have-links-on-how-to-create-sock-puppets-and-gain-rep-fraudulently-i/381635#381635
Yvette had also previously deleted one or two of Ciro's answers for being duplicates, which is a policy Ciro is against: if the questions are not dupes, a single answer might still directly reply to both of them.
Yvette later announced that she was leaving the website: meta.stackoverflow.com/questions/399495/leaving-the-site-and-the-network-mid-election-is-not-the-best-but-theres-no. This is evil, but Ciro was happy. He does not mean harm to Yvette, but in their limited interaction, Ciro disagreed with her choices.
The Great Places Erased by Suburbia by Not Just Bikes (2022)
Source. Stack Overflow, and other online forums, can serve as a sort of a third place for its more active users.Strangeness Minus Three (BBC Horizon 1964)
Source. Basically shows Richard Feynman 15 minutes on a blackboard explaining the experimental basis of the eightfold way really well, while at the same time hyperactively moving all over. The word symmetry gets tossed a few times.NCBI taxonomy entry: www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=511145 This links to:
- genome: www.ncbi.nlm.nih.gov/genome/?term=txid511145 From there there are links to either:
- Download the FASTA: "Download sequences in FASTA format for genome, protein"For the genome, you get a compressed FASTA file with extension
.fna
calledGCF_000005845.2_ASM584v2_genomic.fna
that starts with:>NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG
- Interactively browse the sequence on the browser viewer: "Reference genome: Escherichia coli str. K-12 substr. MG1655" which eventually leads to: www.ncbi.nlm.nih.gov/nuccore/556503834?report=graphIf we zoom into the start, we hover over the very first gene/protein: the famous (just kidding) e. Coli K-12 MG1655 gene thrL, at position 190-255.The second one is the much more interesting e. Coli K-12 MG1655 gene thrA.
- Gene list, with a total of 4,629 as of 2021: www.ncbi.nlm.nih.gov/gene/?term=txid511145
For specific species:
Capital of the Northern Song dynasty. Features in Water Margin.
Ciro Santilli lived there from 1995 to 1997.
Tabla Solo in Jhaptal by Alla Rakha, featuring Ravi Shankar (2003)
Source. Superconductivity is one of the key advances of 21st century technology:
- produce powerful magnetic fields with superconducting magnets
- the Josephson effect, applications listed at: Section "Applications of Josephson Junctions"
Unlisted articles are being shown, click here to show only listed articles.