E. Coli genome starting point Updated 2025-07-16
View more
The conventional starting point is not at the E. Coli K-12 MG1655 origin of replication.
biocyc.org/ECOLI/NEW-IMAGE?type=EXTRAGENIC-SITE&object=G0-10506 explains:
This site is the origin of replication of the E. coli chromosome. It contains the binding sites for DnaA, which is critical for initiation of replication. Replication proceeds bidirectionally. For historical reasons, the numbering of E. coli's circular chromosome does not start at the origin of replication, but at the origin of transfer during conjugation.
If it is a bit hard to understand what they mean by "origin of transfer" though, as that term is usually associated with the origin of transfer of bacterial conjugation.
Read the full article
E. Coli K-12 MG1655 Updated 2025-07-16
View more
NCBI taxonomy entry: www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=511145 This links to:
Read the full article
E. Coli K-12 MG1655 gene dksA Updated 2025-07-16
View more
Read the full article
E. Coli K-12 MG1655 gene fnr Updated 2025-07-16
View more
Read the full article
E. Coli K-12 MG1655 gene thrL Updated 2025-07-16
View more
The first gene in the E. Coli K-12 MG1655 genome. Remember however that bacterial chromosome is circular, so being the first doesn't mean much, how the choice was made: Section "E. Coli genome starting point".
At only 65 bp, this gene is quite small and boring. For a more interesting gene, have a look at the next gene, e. Coli K-12 MG1655 gene thrA.
Does something to do with threonine.
This is the first in the sequence thrL, thrA, thrB, thrC. This type of naming convention is quite common on related adjacent proteins, all of which must be getting transcribed into a single RNA by the same promoter. As mentioned in the analysis of the KEGG entry for e. Coli K-12 MG1655 gene thrA, those A, B and C are actually directly functionally linked in a direct metabolic pathway.
We can see that thrL, A, B, and C are in the same transcription unit by browsing the list of promoter at: biocyc.org/group?id=:ALL-PROMOTERS&orgid=ECOLI. By finding the first one by position we reach; biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486.
Read the full article
E. Coli K-12 MG1655 gene yaaX Updated 2025-07-16
View more
Read the full article
E. Coli K-12 MG1655 promoter Updated 2025-07-16
View more
From this we see that there is a convention of naming promoters as protein name + p, e.g. the first gene in E. Coli K-12 MG1655 promoter thrLp encodes protein thrL.
It is also possible to add numbers after the p, e.g. at biocyc.org/ECOLI/NEW-IMAGE?type=OPERON&object=PM0-45989 we see that the protein zur has two promoters:
  • zurp6
  • zurp7
TODO why 6 and 7? There don't appear to be 1, 2, etc.
Read the full article
E. Coli replication time Updated 2025-07-16
View more
20 minutes in optimal conditions, with a crazy multiple start sites mechanism: E. Coli starts DNA replication before the previous one finished.
Otherwise, naively, would take 60-90 minutes just to replicate and segregate the full DNA otherwise. So it starts copying multiple times.
Read the full article
E. Coli Whole Cell Model by Covert Lab Updated 2025-07-16
View more
The project is written in Python, hurray!
But according to te README, it seems to be the use a code drop model with on-request access to master. Ciro Santilli asked at rationale on GitHub discussion, and they confirmed as expected that it is to:
  • to prevent their publication ideas from being stolen. Who would steal publication ideas with public proof in an issue tracker without crediting original authors? Academia is broken. Academia should be the most open form of knowledge sharing. But instead we get this silly competition for publication points.
  • to prevent noise from non-collaborators. But they only get like 2 issues as year on such a meganiche subject... Did you know that you can ignore people, and even block them if they are particularly annoying? Much more likely is that no one will every hear about your project and that it will die with its last graduate student slave.
The project is a followup to the earlier M. genitalium whole cell model by Covert lab which modelled Mycoplasma genitalium. E. Coli has 8x more genes (500 vs 4k), but it the undisputed bacterial model organism and as such has been studied much more thoroughly. It also reproduces faster than Mycoplasma (20 minutes vs a few hours), which is a huge advantages for validation/exploratory experiments.
The project has a partial dependency on the proprietary optimization software CPLEX which is freeware, for students, not sure what it is used for exactly, from the comment in the requirements.txt the dependency is only partial.
This project makes Ciro Santilli think of the E. Coli as an optimization problem. Given such external nutrient/temperature condition, which DNA sequence makes the cell grow the fastest? Balancing metabolites feels like designing a Factorio speedrun.
There is one major thing missing thing in the current model: promoters/transcription factor interactions are not modelled due to lack/low quality of experimental data: github.com/CovertLab/WholeCellEcoliRelease/issues/21. They just have a magic direct "transcription factor to gene" relationship, encoded at reconstruction/ecoli/flat/foldChanges.tsv in terms of type "if this is present, such protein is expressed 10x more". Transcription units are not implemented at all it appears.
Everything in this section refers to version 7e4cc9e57de76752df0f4e32eca95fb653ea64e4, the code drop from November 2020, and was tested on Ubuntu 21.04 with a docker install of docker.pkg.github.com/covertlab/wholecellecolirelease/wcm-full with image id 502c3e604265, unless otherwise noted.
Read the full article
E. Coli Whole Cell Model by Covert Lab / Other run variants Updated 2025-07-16
View more
Besides time series run variants, conditions can also be selected directly without a time series as in:
python runscripts/manual/runSim.py --variant condition 1 1
which select row indices from reconstruction/ecoli/flat/condition/condition_defs.tsv. The above 1 1 would mean the second line of that file which starts with:
"condition" "nutrients" "genotype perturbations" "doubling time (units.min)" "active TFs"
"basal" "minimal" {} 44.0 []
"no_oxygen" "minimal_minus_oxygen" {} 100.0 []
"with_aa" "minimal_plus_amino_acids" {} 25.0 ["CPLX-125", "MONOMER0-162", "CPLX0-7671", "CPLX0-228", "MONOMER0-155"]
so 1 means no_oxygen.
Read the full article
E. Coli Whole Cell Model by Covert Lab / Output overview Updated 2025-07-16
View more
Run output is placed under out/:
Some of the output data is stored as .cpickle files. To observe those files, you need the original Python classes, and therefore you have to be inside Docker, from the host it won't work.
We can list all the plots that have been produced under out/ with
find -name '*.png'
Plots are also available in SVG and PDF formats, e.g.:
  • PNG: ./out/manual/plotOut/low_res_plots/massFractionSummary.png
  • SVG: ./out/manual/plotOut/svg_plots/massFractionSummary.svg The SVGs write text as polygons, see also: SVG fonts.
  • PDF: ./out/manual/plotOut/massFractionSummary.pdf
The output directory has a hierarchical structure of type:
./out/manual/wildtype_000000/000000/generation_000000/000000/
where:
  • wildtype_000000: variant conditions. wildtype is a human readable label, and 000000 is an index amongst the possible wildtype conditions. For example, we can have different simulations with different nutrients, or different DNA sequences. An example of this is shown at run variants.
  • 000000: initial random seed for the initial cell, likely fed to NumPy's np.random.seed
  • genereation_000000: this will increase with generations if we simulate multiple cells, which is supported by the model
  • 000000: this will presumably contain the cell index within a generation
We also understand that some of the top level directories contain summaries over all cells, e.g. the massFractionSummary.pdf plot exists at several levels of the hierarchy:
./out/manual/plotOut/massFractionSummary.pdf
./out/manual/wildtype_000000/plotOut/massFractionSummary.pdf
./out/manual/wildtype_000000/000000/plotOut/massFractionSummary.pdf
./out/manual/wildtype_000000/000000/generation_000000/000000/plotOut/massFractionSummary.pdf
Each of thoes four levels of plotOut is generated by a different one of the analysis scripts:
  • ./out/manual/plotOut: generated by python runscripts/manual/analysisVariant.py. Contains comparisons of different variant conditions. We confirm this by looking at the results of run variants.
  • ./out/manual/wildtype_000000/plotOut: generated by python runscripts/manual/analysisCohort.py --variant_index 0. TODO not sure how to differentiate between two different labels e.g. wildtype_000000 and somethingElse_000000. If -v is not given, a it just picks the first one alphabetically. TODO not sure how to automatically generate all of those plots without inspecting the directories.
  • ./out/manual/wildtype_000000/000000/plotOut: generated by python runscripts/manual/analysisMultigen.py --variant_index 0 --seed 0
  • ./out/manual/wildtype_000000/000000/generation_000000/000000/plotOut: generated by python runscripts/manual/analysisSingle.py --variant_index 0 --seed 0 --generation 0 --daughter 0. Contains information about a single specific cell.
Read the full article
E. Coli Whole Cell Model by Covert Lab / Publications Updated 2025-07-16
View more
Unfortunately, due to lack of one page to rule them all, the on-Git tree publication list is meager, some of the most relevant ones seems to be:
Read the full article
E. Coli Whole Cell Model by Covert Lab / Source code overview Updated 2025-07-16
View more
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
"n" "CCO-BAC-NUCLEOID"
"j" "CCO-CELL-PROJECTION"
"w" "CCO-CW-BAC-NEG"
"c" "CCO-CYTOSOL"
"e" "CCO-EXTRACELLULAR"
"m" "CCO-MEMBRANE"
"o" "CCO-OUTER-MEM"
"p" "CCO-PERI-BAC"
"l" "CCO-PILUS"
"i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
[91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
"HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
"L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"

"HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
  {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
  false
  ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]

"HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
  {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
  false
  ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
"complexation"
  [
    {
      "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
      "coeff": 1,
      "type": "proteincomplex",
      "location": "c",
      "form": "mature"
    },
    {
      "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
      "coeff": -4,
      "type": "proteinmonomer",
      "location": "c",
      "form": "mature"
    }
  ]
"ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
"aspartate kinase / homoserine dehydrogenase"
""
[0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
["c"]
"ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
"ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
"arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
"fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
"dksA" "EG10230"
Read the full article
Education Updated 2025-07-16
View more
One of the causes Ciro Santilli care the most about: motivation.
A list of complaints against education: Section "Education is broken".
How to improve education? Simple:
Read the full article
Educational charitable organization Updated 2025-07-16
View more
In this section we list charitable organizations that support education or research:
Read the full article
ELF Hello World Tutorial / Program header table Updated 2025-07-16
View more
Only appears in the executable.
Contains information of how the executable should be put into the process virtual memory.
The executable is generated from object files by the linker. The main jobs that the linker does are:
  • determine which sections of the object files will go into which segments of the executable.
    In Binutils, this comes down to parsing a linker script, and dealing with a bunch of defaults.
    You can get the linker script used with ld --verbose, and set a custom one with ld -T.
  • do relocation according to the .rela.text section. This depends on how the multiple sections are put into memory.
readelf -l hello_world.out gives:
Elf file type is EXEC (Executable file)
Entry point 0x4000b0
There are 2 program headers, starting at offset 64

Program Headers:
  Type           Offset             VirtAddr           PhysAddr
                 FileSiz            MemSiz              Flags  Align
  LOAD           0x0000000000000000 0x0000000000400000 0x0000000000400000
                 0x00000000000000d7 0x00000000000000d7  R E    200000
  LOAD           0x00000000000000d8 0x00000000006000d8 0x00000000006000d8
                 0x000000000000000d 0x000000000000000d  RW     200000

 Section to Segment mapping:
  Segment Sections...
   00     .text
   01     .data
On the ELF header, e_phoff, e_phnum and e_phentsize told us that there are 2 program headers, which start at 0x40 and are 0x38 bytes long each, so they are:
00000040  01 00 00 00 05 00 00 00  00 00 00 00 00 00 00 00  |................|
00000050  00 00 40 00 00 00 00 00  00 00 40 00 00 00 00 00  |..@.......@.....|
00000060  d7 00 00 00 00 00 00 00  d7 00 00 00 00 00 00 00  |................|
00000070  00 00 20 00 00 00 00 00                           |.. .....        |
and:
00000070                           01 00 00 00 06 00 00 00  |        ........|
00000080  d8 00 00 00 00 00 00 00  d8 00 60 00 00 00 00 00  |..........`.....|
00000090  d8 00 60 00 00 00 00 00  0d 00 00 00 00 00 00 00  |..`.............|
000000a0  0d 00 00 00 00 00 00 00  00 00 20 00 00 00 00 00  |.......... .....|
Structure represented www.sco.com/developers/gabi/2003-12-17/ch5.pheader.html:
typedef struct {
    Elf64_Word  p_type;
    Elf64_Word  p_flags;
    Elf64_Off   p_offset;
    Elf64_Addr  p_vaddr;
    Elf64_Addr  p_paddr;
    Elf64_Xword p_filesz;
    Elf64_Xword p_memsz;
    Elf64_Xword p_align;
} Elf64_Phdr;
Breakdown of the first one:
  • 40 0: p_type = 01 00 00 00 = PT_LOAD: this is a regular segment that will get loaded in memory.
  • 40 4: p_flags = 05 00 00 00 = execute and read permissions. No write: we cannot modify the text segment. A classic way to do this in C is with string literals: stackoverflow.com/a/30662565/895245 This allows kernels to do certain optimizations, like sharing the segment amongst processes.
  • 40 8: p_offset = 8x 00 TODO: what is this? Standard says:
    This member gives the offset from the beginning of the file at which the first byte of the segment resides.
    But it looks like offsets from the beginning of segments, not file?
  • 50 0: p_vaddr = 00 00 40 00 00 00 00 00: initial virtual memory address to load this segment to
  • 50 8: p_paddr = 00 00 40 00 00 00 00 00: unspecified effect. Intended for systems in which physical addressing matters. TODO example?
  • 60 0: p_filesz = d7 00 00 00 00 00 00 00: size that the segment occupies in memory. If smaller than p_memsz, the OS fills it with zeroes to fit when loading the program. This is how BSS data is implemented to save space on executable files. i368 ABI says on PT_LOAD:
    The bytes from the file are mapped to the beginning of the memory segment. If the segment’s memory size (p_memsz) is larger than the file size (p_filesz), the ‘‘extra’’ bytes are defined to hold the value 0 and to follow the segment’s initialized area. The file size may not be larger than the memory size.
  • 60 8: p_memsz = d7 00 00 00 00 00 00 00: size that the segment occupies in memory
  • 70 0: p_align = 00 00 20 00 00 00 00 00: 0 or 1 mean no alignment required. TODO why is this required? Why not just use p_addr directly, and get that right? Docs also say:
    p_vaddr should equal p_offset, modulo p_align
The second segment (.data) is analogous. TODO: why use offset 0x0000d8 and address 0x00000000006000d8? Why not just use 0 and 0x00000000006000d8?
Then the:
 Section to Segment mapping:
section of the readelf tells us that:
  • 0 is the .text segment. Aha, so this is why it is executable, and not writable
  • 1 is the .data segment.
Read the full article
Education as a system of indoctrination Updated 2025-07-16
View more
Whenever Ciro Santilli walks in front of a school and sees the tall gates it makes him sad. Maybe 8 year olds need gates. But do we need to protect 15 year olds like that? Students should be going out to see the world, both good and evil not hiding from it! We should instead be guiding them to the world. But instead, we are locking them up in brainwashing centers.
Video "The Purpose of Education by Noam Chomsky (2012)" puts it well, education can be either be:
He has spoken about that infinitely, e.g. from when he was thin: www.youtube.com/watch?v=JVqMAlgAnlo
Bibliography:
Read the full article
Edward Witten Updated 2025-07-16
View more
This dude is generally viewed as a God. His incredibly understated demeanor and tone certainly help.
Video 1.
Unintentional ASMR | Sleepiest Interview Ever | Edward Witten
. Source. The title of this reupload is just epic. Edward telling his biography.
Read the full article
Effect of a change of basis on the matrix of a bilinear form Updated 2025-07-16
View more
If is the change of basis matrix, then the matrix representation of a bilinear form that looked like:
(1)
then the matrix in the new basis is:
(2)
Sylvester's law of inertia then tells us that the number of positive, negative and 0 eigenvalues of both of those matrices is the same.
Proof: the value of a given bilinear form cannot change due to a change of basis, since the bilinear form is just a function, and does not depend on the choice of basis. The only thing that change is the matrix representation of the form. Therefore, we must have:
(3)
and in the new basis:
(4)
and so since:
(5)
Read the full article
Eigendecomposition of a real symmetric matrix Updated 2025-07-16
View more
The general result from eigendecomposition of a matrix:
(1)
becomes:
(2)
where is an orthogonal matrix, and therefore has .
Read the full article

There are unlisted articles, also show them or only show them.