Unfortunately, due to lack of one page to rule them all, the on-Git tree publication list is meager, some of the most relevant ones seems to be:
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
    "n" "CCO-BAC-NUCLEOID"
    "j" "CCO-CELL-PROJECTION"
    "w" "CCO-CW-BAC-NEG"
    "c" "CCO-CYTOSOL"
    "e" "CCO-EXTRACELLULAR"
    "m" "CCO-MEMBRANE"
    "o" "CCO-OUTER-MEM"
    "p" "CCO-PERI-BAC"
    "l" "CCO-PILUS"
    "i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
    148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
    [91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
    174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
    AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
    0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
    657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
    66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
    2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
    "HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    "L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
      {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
      {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
    "complexation"
      [
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
          "coeff": 1,
          "type": "proteincomplex",
          "location": "c",
          "form": "mature"
        },
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
          "coeff": -4,
          "type": "proteinmonomer",
          "location": "c",
          "form": "mature"
        }
      ]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
    "aspartate kinase / homoserine dehydrogenase"
    ""
    [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
    ["c"]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    "ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
    "arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
    "fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
    "dksA" "EG10230"
Education Updated 2025-07-16
One of the causes Ciro Santilli care the most about: motivation.
A list of complaints against education: Section "Education is broken".
How to improve education? Simple:
Educational charitable organization Updated 2025-07-16
In this section we list charitable organizations that support education or research:
Only appears in the executable.
Contains information of how the executable should be put into the process virtual memory.
The executable is generated from object files by the linker. The main jobs that the linker does are:
  • determine which sections of the object files will go into which segments of the executable.
    In Binutils, this comes down to parsing a linker script, and dealing with a bunch of defaults.
    You can get the linker script used with ld --verbose, and set a custom one with ld -T.
  • do relocation according to the .rela.text section. This depends on how the multiple sections are put into memory.
readelf -l hello_world.out gives:
Elf file type is EXEC (Executable file)
Entry point 0x4000b0
There are 2 program headers, starting at offset 64

Program Headers:
  Type           Offset             VirtAddr           PhysAddr
                 FileSiz            MemSiz              Flags  Align
  LOAD           0x0000000000000000 0x0000000000400000 0x0000000000400000
                 0x00000000000000d7 0x00000000000000d7  R E    200000
  LOAD           0x00000000000000d8 0x00000000006000d8 0x00000000006000d8
                 0x000000000000000d 0x000000000000000d  RW     200000

 Section to Segment mapping:
  Segment Sections...
   00     .text
   01     .data
On the ELF header, e_phoff, e_phnum and e_phentsize told us that there are 2 program headers, which start at 0x40 and are 0x38 bytes long each, so they are:
00000040  01 00 00 00 05 00 00 00  00 00 00 00 00 00 00 00  |................|
00000050  00 00 40 00 00 00 00 00  00 00 40 00 00 00 00 00  |..@.......@.....|
00000060  d7 00 00 00 00 00 00 00  d7 00 00 00 00 00 00 00  |................|
00000070  00 00 20 00 00 00 00 00                           |.. .....        |
and:
00000070                           01 00 00 00 06 00 00 00  |        ........|
00000080  d8 00 00 00 00 00 00 00  d8 00 60 00 00 00 00 00  |..........`.....|
00000090  d8 00 60 00 00 00 00 00  0d 00 00 00 00 00 00 00  |..`.............|
000000a0  0d 00 00 00 00 00 00 00  00 00 20 00 00 00 00 00  |.......... .....|
Structure represented www.sco.com/developers/gabi/2003-12-17/ch5.pheader.html:
typedef struct {
    Elf64_Word  p_type;
    Elf64_Word  p_flags;
    Elf64_Off   p_offset;
    Elf64_Addr  p_vaddr;
    Elf64_Addr  p_paddr;
    Elf64_Xword p_filesz;
    Elf64_Xword p_memsz;
    Elf64_Xword p_align;
} Elf64_Phdr;
Breakdown of the first one:
  • 40 0: p_type = 01 00 00 00 = PT_LOAD: this is a regular segment that will get loaded in memory.
  • 40 4: p_flags = 05 00 00 00 = execute and read permissions. No write: we cannot modify the text segment. A classic way to do this in C is with string literals: stackoverflow.com/a/30662565/895245 This allows kernels to do certain optimizations, like sharing the segment amongst processes.
  • 40 8: p_offset = 8x 00 TODO: what is this? Standard says:
    This member gives the offset from the beginning of the file at which the first byte of the segment resides.
    But it looks like offsets from the beginning of segments, not file?
  • 50 0: p_vaddr = 00 00 40 00 00 00 00 00: initial virtual memory address to load this segment to
  • 50 8: p_paddr = 00 00 40 00 00 00 00 00: unspecified effect. Intended for systems in which physical addressing matters. TODO example?
  • 60 0: p_filesz = d7 00 00 00 00 00 00 00: size that the segment occupies in memory. If smaller than p_memsz, the OS fills it with zeroes to fit when loading the program. This is how BSS data is implemented to save space on executable files. i368 ABI says on PT_LOAD:
    The bytes from the file are mapped to the beginning of the memory segment. If the segment’s memory size (p_memsz) is larger than the file size (p_filesz), the ‘‘extra’’ bytes are defined to hold the value 0 and to follow the segment’s initialized area. The file size may not be larger than the memory size.
  • 60 8: p_memsz = d7 00 00 00 00 00 00 00: size that the segment occupies in memory
  • 70 0: p_align = 00 00 20 00 00 00 00 00: 0 or 1 mean no alignment required. TODO why is this required? Why not just use p_addr directly, and get that right? Docs also say:
    p_vaddr should equal p_offset, modulo p_align
The second segment (.data) is analogous. TODO: why use offset 0x0000d8 and address 0x00000000006000d8? Why not just use 0 and 0x00000000006000d8?
Then the:
 Section to Segment mapping:
section of the readelf tells us that:
  • 0 is the .text segment. Aha, so this is why it is executable, and not writable
  • 1 is the .data segment.
Whenever Ciro Santilli walks in front of a school and sees the tall gates it makes him sad. Maybe 8 year olds need gates. But do we need to protect 15 year olds like that? Students should be going out to see the world, both good and evil not hiding from it! We should instead be guiding them to the world. But instead, we are locking them up in brainwashing centers.
Video "The Purpose of Education by Noam Chomsky (2012)" puts it well, education can be either be:
He has spoken about that infinitely, e.g. from when he was thin: www.youtube.com/watch?v=JVqMAlgAnlo
Bibliography:
Edward Snowden Updated 2025-07-16
Figure 1. . Source. From the film Prism, during interview with reporter Glenn Greenwald.
Video 1.
Edward Snowden original interview cut by The Guardian (2013)
Source.
Edward Witten Updated 2025-07-16
This dude is generally viewed as a God. His incredibly understated demeanor and tone certainly help.
Video 1.
Unintentional ASMR | Sleepiest Interview Ever | Edward Witten
. Source. The title of this reupload is just epic. Edward telling his biography.
If is the change of basis matrix, then the matrix representation of a bilinear form that looked like:
then the matrix in the new basis is:
Sylvester's law of inertia then tells us that the number of positive, negative and 0 eigenvalues of both of those matrices is the same.
Proof: the value of a given bilinear form cannot change due to a change of basis, since the bilinear form is just a function, and does not depend on the choice of basis. The only thing that change is the matrix representation of the form. Therefore, we must have:
and in the new basis:
and so since:
The general result from eigendecomposition of a matrix:
becomes:
where is an orthogonal matrix, and therefore has .
Eightfold way (physics) Updated 2025-07-16
Video 1.
Strangeness Minus Three (BBC Horizon 1964)
Source. Basically shows Richard Feynman 15 minutes on a blackboard explaining the experimental basis of the eightfold way really well, while at the same time hyperactively moving all over. The word symmetry gets tossed a few times.
E Ink Updated 2025-07-16
Electronic Ink such as that found on Amazon Kindle is the greatest invention ever made by man.
Once E Ink reaches reasonable refresh rates to replace liquid crystal displays, the world will finally be saved.
It would allow Ciro Santilli to spend his entire life in front of a screen rather in the real world without getting tired eyes, and even if it is sunny outside.
Ciro stopped reading non-code non-news a while back though, so the current refresh rates are useless, what a shame.
OMG, this is amazing: getfreewrite.com/
ELF Hello World Tutorial / PT_INTERP Updated 2025-07-16
Contains the path to the dynamic loader, i.e. /lib64/ld-linux-x86-64.so.2 in Ubuntu 18.10. Explained at: stackoverflow.com/questions/8040631/checking-if-a-binary-compiled-with-static/55664341#55664341
Einstein notation Updated 2025-07-16
The Wikipedia page of this article is basically a masterclass why Wikipedia is useless for learning technical subjects. They are not even able to teach such a simple subject properly there!
Bibliography:
The Einstein summation convention works will with partial derivatives and it is widely used in particle physics.
In particular, the divergence and the Laplacian can be succinctly expressed in this notation:
In order to express partial derivatives, we must use what Ciro Santilli calls the "partial index partial derivative notation", which refers to variables with indices such as , , , , and instead of the usual letters , and .
E-learning website Updated 2025-07-16
Generally, if something is labelled as "e-learning", it's not a good sign, as it implies that it adheres to the "teacher"/"student" separation which Ciro Santilli much despises: E-learning websites must allow students to create learning content.

There are unlisted articles, also show them or only show them.