Mass fraction summary plot analysis Updated 2024-12-15 +Created 2024-12-04
View more
Let's look into a sample plot, out/manual/plotOut/svg_plots/massFractionSummary.svg, and try to understand as much as we can about what it means and how it was generated.
This plot contains how much of each type of mass is present in all cells. Since we simulated just one cell, it will be the same as the results for that cell.
We can see that all of them grow more or less linearly, perhaps as the start of an exponential. We can see that all of them grow more or less linearly, perhaps as the start of an exponential. We can see that all of them grow more or less linearly, perhaps as the start of an exponential.
  • total dry mass (mass excluding water)
  • protein mass
  • rRNA mass
  • mRNA mass
  • DNA mass. The last label is not very visible on the plots, but we can deduce it from the source code.
By grepping the title "Cell mass fractions" in the source code, we see the files:
models/ecoli/analysis/cohort/massFractionSummary.py
models/ecoli/analysis/multigen/massFractionSummary.py
models/ecoli/analysis/variant/massFractionSummary.py
which must correspond to the different massFractionSummary plots throughout different levels of the hierarchy.
By reading models/ecoli/analysis/variant/massFractionSummary.py a little bit, we see that:
  • the plotting is done with Matplotlib, hurray
  • it is reading its data from files under ./out/manual/wildtype_000000/000000/generation_000000/000000/simOut/Mass/, more precisely ./out/manual/wildtype_000000/000000/generation_000000/000000/simOut/Mass/columns/<column-name>/data. They are binary files however.
    Looking at the source for wholecell/io/tablereader.py shows that those are just a standard NumPy serialization mechanism. Maybe they should have used the Hierarchical Data Format instead.
    We can also take this opportunity to try and find where the data is coming from. Mass from the ./out/manual/wildtype_000000/000000/generation_000000/000000/simOut/Mass/ looks like an ID, so we grep that and we reach models/ecoli/listeners/mass.py.
    From this we understand that all data that is to be saved from a simulation must be coming from listeners: likely nothing, or not much, is dumped by default, because otherwise it would take up too much disk space. You have to explicitly say what it is that you want to save via a listener that acts on each time step.
Figure 1.
Minimal condition mass fraction plot
. Source. File name: out/manual/plotOut/svg_plots/massFractionSummary.svg
More plot types will be explored at time series run variant, where we will contrast two runs with different growth mediums.
Read the full article
Source code overview Updated 2024-12-15 +Created 1970-01-01
View more
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
"n" "CCO-BAC-NUCLEOID"
"j" "CCO-CELL-PROJECTION"
"w" "CCO-CW-BAC-NEG"
"c" "CCO-CYTOSOL"
"e" "CCO-EXTRACELLULAR"
"m" "CCO-MEMBRANE"
"o" "CCO-OUTER-MEM"
"p" "CCO-PERI-BAC"
"l" "CCO-PILUS"
"i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
[91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
    • aaCount: amino acid count, how many of each of the 20 proteinogenic amino acid are there
    • seq: full sequence, using the single letter abbreviation of the proteinogenic amino acids
    • mw; molecular weight? The 11 components appear to be given at reconstruction/ecoli/flat/scripts/unifyBulkFiles.py:
      molecular_weight_keys = [
  '23srRNA',
  '16srRNA',
  '5srRNA',
  'tRNA',
  'mRNA',
  'miscRNA',
  'protein',
  'metabolite',
  'water',
  'DNA',
  'RNA' # nonspecific RNA
  ]
      so they simply classify the weight? Presumably this exists for complexes that have multiple classes?
    • location: cell compartment where the protein is present, c defined at reconstruction/ecoli/flat/compartments.tsv as cytoplasm, as expected for something that will make an amino acid
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
    • halfLife: half-life
    • mw: molecular weight, same as in reconstruction/ecoli/flat/proteins.tsv. This molecule only have weight in the mRNA class, as expected, as it just codes for a protein
    • location: same as in reconstruction/ecoli/flat/proteins.tsv
    • ntCount: nucleotide count for each of the ATGC
    • microarray expression: presumably refers to DNA microarray for gene expression profiling, but what measure exactly?
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
"HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
"L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"

"HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
  {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
  false
  ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]

"HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
  {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
  false
  ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
"complexation"
  [
    {
      "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
      "coeff": 1,
      "type": "proteincomplex",
      "location": "c",
      "form": "mature"
    },
    {
      "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
      "coeff": -4,
      "type": "proteinmonomer",
      "location": "c",
      "form": "mature"
    }
  ]
"ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
"aspartate kinase / homoserine dehydrogenase"
""
[0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
["c"]
"ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
"ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
"arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
"fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
"dksA" "EG10230"
Read the full article
Ice Updated 2024-12-15 +Created 1970-01-01
View more
Ice is the name of one of the solid phases of water.
In informal contexts, it usually refers to the phase of ice observed in atmospheric pressure, Ice Ih.
Read the full article
Second-order phase transition Updated 2024-12-15 +Created 1970-01-01
View more
The more familiar transitions we are familiar with like liquid water into solid water happen at constant temperature.
However, other types of phase transitions we are less familiar in our daily lives happen across a continuum of such "state variables", notably:
Read the full article
Water Updated 2024-12-15 +Created 1970-01-01
View more
"Water" is the name for both:
Figure 1.
Water in a glass
. Source.
Figure 2.
Ball-and-stick model of a water molecule
. Source.
Figure 3.
Simplified phase diagram of water
. Source. Note the triple point and critical point visible. Phase diagrams are so cool!
Figure 4.
Phase diagram of water
. Source. Note all the obscure phases of ice.
Read the full article