Incoming links: E. Coli K-12 MG1655 gene thrA
Database of promoter.
E.g. for E. Coli K-12 MG1655: biocyc.org/group?id=:ALL-PROMOTERS&orgid=ECOLI For some context see e. Coli K-12 MG1655 gene thrL + e. Coli K-12 MG1655 gene thrA + thrB + thrC all of which are in the same transcription unit.
NCBI taxonomy entry: www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=511145 This links to:
- genome: www.ncbi.nlm.nih.gov/genome/?term=txid511145 From there there are links to either:
- Download the FASTA: "Download sequences in FASTA format for genome, protein"For the genome, you get a compressed FASTA file with extension
.fnacalledGCF_000005845.2_ASM584v2_genomic.fnathat starts with:>NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG
- Interactively browse the sequence on the browser viewer: "Reference genome: Escherichia coli str. K-12 substr. MG1655" which eventually leads to: www.ncbi.nlm.nih.gov/nuccore/556503834?report=graphIf we zoom into the start, we hover over the very first gene/protein: the famous (just kidding) e. Coli K-12 MG1655 gene thrL, at position 190-255.The second one is the much more interesting e. Coli K-12 MG1655 gene thrA.
- Gene list, with a total of 4,629 as of 2021: www.ncbi.nlm.nih.gov/gene/?term=txid511145
Immediately follows e. Coli K-12 MG1655 gene thrA,
Part of E. Coli K-12 MG1655 operon thrLABC.
NCBI gene entry: www.ncbi.nlm.nih.gov/gene/944742.
The first gene in the E. Coli K-12 MG1655 genome. Remember however that bacterial chromosome is circular, so being the first doesn't mean much, how the choice was made: Section "E. Coli genome starting point".
Part of E. Coli K-12 MG1655 operon thrLABC.
At only 65 bp, this gene is quite small and boring. For a more interesting gene, have a look at the next gene, e. Coli K-12 MG1655 gene thrA.
Does something to do with threonine.
This is the first in the sequence thrL, thrA, thrB, thrC. This type of naming convention is quite common on related adjacent proteins, all of which must be getting transcribed into a single RNA by the same promoter. As mentioned in the analysis of the KEGG entry for e. Coli K-12 MG1655 gene thrA, those A, B and C are actually directly functionally linked in a direct metabolic pathway.
We can see that thrL, A, B, and C are in the same transcription unit by browsing the list of promoter at: biocyc.org/group?id=:ALL-PROMOTERS&orgid=ECOLI. By finding the first one by position we reach; biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486.
Contains the genes: e. Coli K-12 MG1655 gene thrL, e. Coli K-12 MG1655 gene thrA, e. Coli K-12 MG1655 gene thrB and e. Coli K-12 MG1655 gene thrC, all of which have directly linked functionality.
We can find it by searching for the species in the BioCyc promoter database. This leads to: biocyc.org/group?id=:ALL-PROMOTERS&orgid=ECOLI.
By finding the first operon by position we reach: biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486.
That page lists several components of the promoter, which we should try to understand!
Some of the transcription factors are proteins:
After the first gene in the codon, thrL, there is a rho-independent termination. By comparing:we understand that the presence of threonine or isoleucine variants, L-threonyl and L-isoleucyl, makes the rho-independent termination become more efficient, so the control loop is quite direct! Not sure why it cares about isoleucine as well though.
TODO which factor is actually specific to that DNA region?
The key model database is located in the source code at
reconstruction/ecoli/flat.Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
reconstruction/ecoli/flat/compartments.tsvcontains cellular compartment information:"abbrev" "id" "n" "CCO-BAC-NUCLEOID" "j" "CCO-CELL-PROJECTION" "w" "CCO-CW-BAC-NEG" "c" "CCO-CYTOSOL" "e" "CCO-EXTRACELLULAR" "m" "CCO-MEMBRANE" "o" "CCO-OUTER-MEM" "p" "CCO-PERI-BAC" "l" "CCO-PILUS" "i" "CCO-PM-BAC-NEG"CCO: "Celular COmpartment"BAC-NUCLEOID: nucleoidCELL-PROJECTION: cell projectionCW-BAC-NEG: TODO confirm: cell wall (of a Gram-negative bacteria)CYTOSOL: cytosolEXTRACELLULAR: outside the cellMEMBRANE: cell membraneOUTER-MEM: bacterial outer membranePERI-BAC: periplasmPILUS: pilusPM-BAC-NEG: TODO: plasma membrane, but that is the same as cell membrane no?
reconstruction/ecoli/flat/promoters.tsvcontains promoter information. Simple file, sample lines:corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148."position" "direction" "id" "name" 148 "+" "PM00249" "thrLp"reconstruction/ecoli/flat/proteins.tsvcontains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:so we understand that:"aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId" [91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"aaCount: amino acid count, how many of each of the 20 proteinogenic amino acid are thereseq: full sequence, using the single letter abbreviation of the proteinogenic amino acidsmw; molecular weight? The 11 components appear to be given atreconstruction/ecoli/flat/scripts/unifyBulkFiles.py:so they simply classify the weight? Presumably this exists for complexes that have multiple classes?molecular_weight_keys = [ '23srRNA', '16srRNA', '5srRNA', 'tRNA', 'mRNA', 'miscRNA', 'protein', 'metabolite', 'water', 'DNA', 'RNA' # nonspecific RNA ]23srRNA,16srRNA,5srRNAare the three structural RNAs present in the ribosome: 23S ribosomal RNA, 16S ribosomal RNA, 5S ribosomal RNA, all others are obvious:- tRNA
- mRNA
- protein. This is the seventh class, and this enzyme only contains mass in this class as expected.
- metabolite
- water
- DNA
- RNA: TODO
rnavsmiscRNA
location: cell compartment where the protein is present,cdefined atreconstruction/ecoli/flat/compartments.tsvas cytoplasm, as expected for something that will make an amino acid
reconstruction/ecoli/flat/rnas.tsv: TODO vstranscriptionUnits.tsv. Sample lines:"halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression" 174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904halfLife: half-lifemw: molecular weight, same as inreconstruction/ecoli/flat/proteins.tsv. This molecule only have weight in themRNAclass, as expected, as it just codes for a proteinlocation: same as inreconstruction/ecoli/flat/proteins.tsvntCount: nucleotide count for each of the ATGCmicroarray expression: presumably refers to DNA microarray for gene expression profiling, but what measure exactly?
reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:>E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp) AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGreconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:"expression_rate" "direction" "right" "terminator_id" "name" "promoter_id" "degradation_rate" "id" "gene_id" "left" 0.0 "f" 310 ["TERM0-1059"] "thrL" "PM00249" 0.198905992329492 "TU0-42486" ["EG11277"] 148 657.057317358791 "f" 5022 ["TERM_WC-2174"] "thrLABC" "PM00249" 0.231049060186648 "TU00178" ["EG10998", "EG10999", "EG11000", "EG11277"] 148promoter_id: matches promoter id inreconstruction/ecoli/flat/promoters.tsvgene_id: matches id inreconstruction/ecoli/flat/genes.tsvid: matches exactly those used in BioCyc, which is quite nice, might be more or less standardized:
reconstruction/ecoli/flat/genes.tsv"length" "name" "seq" "rnaId" "coordinate" "direction" "symbol" "type" "id" "monomerId" 66 "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189 "+" "thrL" "mRNA" "EG11277" "EG11277-MONOMER" 2463 "ThrA" "ATGCGAGTGTTG" "EG10998_RNA" 336 "+" "thrA" "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"reconstruction/ecoli/flat/metabolites.tsvcontains metabolite information. Sample lines:In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine"."id" "mw7.2" "location" "HOMO-SER" 119.12 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"] "L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction IDHOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:so these are the compounds that we care about.- biocyc.org/compound?orgid=ECOLI&id=L-ASPARTATE-SEMIALDEHYDE: "L-aspartate 4-semialdehyde" has ID
L-ASPARTATE-SEMIALDEHYDE - biocyc.org/compound?orgid=ECOLI&id=HOMO-SER: "Homoserine" has ID
HOMO-SER
- biocyc.org/compound?orgid=ECOLI&id=L-ASPARTATE-SEMIALDEHYDE: "L-aspartate 4-semialdehyde" has ID
reconstruction/ecoli/flat/reactions.tsvcontains chemical reaction information. Sample lines:"reaction id" "stoichiometry" "is reversible" "catalyzed by" "HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51." {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1} false ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"] "HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53." {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1 false ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]catalized by: here we seeASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out ofASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for thethrAwe care about! This is confirmed incomplexationReactions.tsv.
reconstruction/ecoli/flat/complexationReactions.tsvcontains information about chemical reactions that produce protein complexes:The"process" "stoichiometry" "id" "dir" "complexation" [ { "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX", "coeff": 1, "type": "proteincomplex", "location": "c", "form": "mature" }, { "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER", "coeff": -4, "type": "proteinmonomer", "location": "c", "form": "mature" } ] "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN" 1coeffis how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:Fantastic literature summary! Can't find that in database form there however.Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
reconstruction/ecoli/flat/proteinComplexes.tsvcontains protein complex information:"name" "comments" "mw" "location" "reactionId" "id" "aspartate kinase / homoserine dehydrogenase" "" [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0] ["c"] "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN" "ASPKINIHOMOSERDEHYDROGI-CPLX"reconstruction/ecoli/flat/protein_half_lives.tsvcontains the half-life of proteins. Very few proteins are listed however for some reason.reconstruction/ecoli/flat/tfIds.csv: transcription factors information:"TF" "geneId" "oneComponentId" "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes" "arcA" "EG10061" "PHOSPHO-ARCA" "PHOSPHO-ARCA" "fnr" "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX" "dksA" "EG10230"
For an initial concrete example, consider e. Coli K-12 MG1655 gene thrA.
How Enzymes Work by RCSBProteinDataBank (2017)
Source. Shows in detail how aconitase catalyses the citrate to isocitrate reaction in the citric acid cycle.For a commented initial example, see: e. Coli K-12 MG1655 gene thrA.
KEGG does the visual maps well.
But BioCyc is generally better otherwise.
Multiple genes coding for multiple proteins in one transcription unit, e.g. e. Coli K-12 MG1655 gene thrL and e. Coli K-12 MG1655 gene thrA are both prat of the E. Coli K-12 MG1655 operon thrLABC.
For an example with context, have a look at E. Coli K-12 MG1655 and the second protein of the genome, e. Coli K-12 MG1655 gene thrA.