Butterfly dream by Ciro Santilli 40 Updated 2025-07-16
Chapter 2 paragraph 14:
Formerly, I, Zhuang Zhou, dreamt that I was a butterfly, a butterfly flying about, feeling that it was enjoying itself. I did not know that it was Zhou. Suddenly I awoke, and was myself again, the veritable Zhou. I did not know whether it had formerly been Zhou dreaming that he was a butterfly, or it was now a butterfly dreaming that it was Zhou. But between Zhou and a butterfly there must be a difference. This is a case of what is called the Transformation of Things.'
Political correctness by Ciro Santilli 40 Updated 2025-07-16
Ciro Santilli believes it generally hurts more than it helps.
Especially when you can't even mention censored things to criticize them. You have to pretend they never existed. So people will forget about them, and do them again in the future.
And when companies do it just to look good, even though it has absolutely no real impact on the lives of those who are discriminated against.
The default run variant, if you don't pass any options, just has the minimal growth conditions set. What this means can be seen at condition.
Notably, this implies a growth medium that includes glucose and salt. It also includes oxygen, which is not strictly required, but greatly benefits cell growth, and is of course easier to have than not have as it is part of the atmosphere!
But the medium does not include amino acids, which the bacteria will have to produce by itself.
Besides time series run variants, conditions can also be selected directly without a time series as in:
python runscripts/manual/runSim.py --variant condition 1 1
which select row indices from reconstruction/ecoli/flat/condition/condition_defs.tsv. The above 1 1 would mean the second line of that file which starts with:
"condition" "nutrients" "genotype perturbations" "doubling time (units.min)" "active TFs"
"basal" "minimal" {} 44.0 []
"no_oxygen" "minimal_minus_oxygen" {} 100.0 []
"with_aa" "minimal_plus_amino_acids" {} 25.0 ["CPLX-125", "MONOMER0-162", "CPLX0-7671", "CPLX0-228", "MONOMER0-155"]
so 1 means no_oxygen.
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
    "n" "CCO-BAC-NUCLEOID"
    "j" "CCO-CELL-PROJECTION"
    "w" "CCO-CW-BAC-NEG"
    "c" "CCO-CYTOSOL"
    "e" "CCO-EXTRACELLULAR"
    "m" "CCO-MEMBRANE"
    "o" "CCO-OUTER-MEM"
    "p" "CCO-PERI-BAC"
    "l" "CCO-PILUS"
    "i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
    148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
    [91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
    174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
    AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
    0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
    657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
    66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
    2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
    "HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    "L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
      {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
      {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
    "complexation"
      [
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
          "coeff": 1,
          "type": "proteincomplex",
          "location": "c",
          "form": "mature"
        },
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
          "coeff": -4,
          "type": "proteinmonomer",
          "location": "c",
          "form": "mature"
        }
      ]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
    "aspartate kinase / homoserine dehydrogenase"
    ""
    [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
    ["c"]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    "ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
    "arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
    "fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
    "dksA" "EG10230"
By GitHub around Black Lives Matter, due to a possible ludicrous relationship with slavery of black people:For the love of God, the word "master" is much more general than black slavery. If you are going to ban it, you might as well ban the word "evil".
Several software projects followed the purge from their codebases, maybe GitHub followed someone else's lead, it's hard to say.
The words "whitelist" and "blacklist" were also targeted.
But by looking at the URLs of the screenshots they provided from other websites we can easily uncover all others that had screenshots, except for the Johnny Carson one, which is just generically named. E.g. the image for the Chinese one is www.reuters.com/investigates/special-report/assets/usa-spies-iran/screencap-activegaminginfo.com.jpg?v=192516290922 which leads us to domain activegaminginfo.com.
Oleg Shakirov later discovered that the Carson one had its domain written right on the screenshot, as part of a watermark present on the original website itself. Therefore the URLs of all the websites were in one way or another essentially given on the article.
The full list of domains from screenshots is:
This is notably what the United States emerged to be after World War II. But it was likely what Nazi Germany also was, and many other superpowers.
Ciro Santilli feels that much more relevant would be to also include academia as in "military-industrial-academic" complex, the Wikipedia page actually mentions precedents to this idea.
The addition of congress/politicians is also relevant.
But hey, the name wouldn't sound so slick with three parts.
It is basically in this context that American science and technology flourished after World War II, including notably the development of quantum electrodynamics, Richard Feynman being a prototypical example, having previously worked on the Manhattan Project.
Spin number of a field by Ciro Santilli 40 Updated 2025-07-16
Physics from Symmetry by Jakob Schwichtenberg (2015) chapter 3.9 "Elementary particles" has an amazing summary of the preceding chapters the spin value has a relation to the representations of the Lorentz group, which encodes the spacetime symmetry that each particle observes. These symmetries can be characterized by small integer numbers:
As usual, we don't know why there aren't elementary particles with other spins, as we could construct them.
Unfortunately, due to lack of one page to rule them all, the on-Git tree publication list is meager, some of the most relevant ones seems to be:
One promising way to find more of those would be with IP searches, since it was stated in the Reuters article that the CIA made the terrible mistake of using several contiguous IP blocks for those website. What a phenomenal OPSEC failure!!!
The easiest way would be if Wayback Machine itself had an IP search function, but we couldn't find one: Search Wayback Machine by IP.
viewdns.info was the first easily accessible website that Ciro Santilli could find that contained such information.
Our current results indicate that the typical IP range is about 30 IPs wide.
E.g. searching: viewdns.info/iphistory and considering only hits from 2011 or earlier we obtain:
Neither of these seem to be in the same ranges, the only common nearby hit amongst these ranges is the exact 68.178.232.100, and doing reverse IP search at viewdns.info/reverseip/?host=68.178.232.100&t=1 states that it has 2.5 million hostnames associated to it, so it must be some kind of Shared web hosting service, see also: superuser.com/questions/577070/is-it-possible-for-many-domain-names-to-share-one-ip-address, which makes search hard.
Ciro then tried some of the other IPs, and soon hit gold.
Initially, Ciro started by doing manual queries to viewdns.info/reversip until his IP was blocked. Then he created an account and used his 250 free queries with the following helper script: ../cia-2010-covert-communication-websites/viewdns-info.sh. The output of that script can be seen at: github.com/cirosantilli/media/blob/master/cia-2010-covert-communication-websites/viewdns-info.sh.
Ciro then found 2013 DNS Census which contained data highly disjoint form the viewdns-info one!
Summaries of the IP range exploration done so far follows, combined data from all databases above.

Pinned article: Introduction to the OurBigBook Project

Welcome to the OurBigBook Project! Our goal is to create the perfect publishing platform for STEM subjects, and get university-level students to write the best free STEM tutorials ever.
Everyone is welcome to create an account and play with the site: ourbigbook.com/go/register. We belive that students themselves can write amazing tutorials, but teachers are welcome too. You can write about anything you want, it doesn't have to be STEM or even educational. Silly test content is very welcome and you won't be penalized in any way. Just keep it legal!
We have two killer features:
  1. topics: topics group articles by different users with the same title, e.g. here is the topic for the "Fundamental Theorem of Calculus" ourbigbook.com/go/topic/fundamental-theorem-of-calculus
    Articles of different users are sorted by upvote within each article page. This feature is a bit like:
    • a Wikipedia where each user can have their own version of each article
    • a Q&A website like Stack Overflow, where multiple people can give their views on a given topic, and the best ones are sorted by upvote. Except you don't need to wait for someone to ask first, and any topic goes, no matter how narrow or broad
    This feature makes it possible for readers to find better explanations of any topic created by other writers. And it allows writers to create an explanation in a place that readers might actually find it.
    Figure 1.
    Screenshot of the "Derivative" topic page
    . View it live at: ourbigbook.com/go/topic/derivative
  2. local editing: you can store all your personal knowledge base content locally in a plaintext markup format that can be edited locally and published either:
    This way you can be sure that even if OurBigBook.com were to go down one day (which we have no plans to do as it is quite cheap to host!), your content will still be perfectly readable as a static site.
    Figure 2.
    You can publish local OurBigBook lightweight markup files to either https://OurBigBook.com or as a static website
    .
    Figure 3.
    Visual Studio Code extension installation
    .
    Figure 4.
    Visual Studio Code extension tree navigation
    .
    Figure 5.
    Web editor
    . You can also edit articles on the Web editor without installing anything locally.
    Video 3.
    Edit locally and publish demo
    . Source. This shows editing OurBigBook Markup and publishing it using the Visual Studio Code extension.
    Video 4.
    OurBigBook Visual Studio Code extension editing and navigation demo
    . Source.
  3. https://raw.githubusercontent.com/ourbigbook/ourbigbook-media/master/feature/x/hilbert-space-arrow.png
  4. Infinitely deep tables of contents:
    Figure 6.
    Dynamic article tree with infinitely deep table of contents
    .
    Descendant pages can also show up as toplevel e.g.: ourbigbook.com/cirosantilli/chordate-subclade
All our software is open source and hosted at: github.com/ourbigbook/ourbigbook
Further documentation can be found at: docs.ourbigbook.com
Feel free to reach our to us for any help or suggestions: docs.ourbigbook.com/#contact