It would be boring if we could only simulate the same condition all the time, so let's have a look at the different boundary conditions that we can apply to the cell!
We are able to alter things like the composition of the external medium, and the genome of the bacteria, which will make the bacteria behave differently.
The variant selection is abit cumbersome aswe have to use indexes instead of names, but one you know what you are doing, it is fine.
For the genome, you get a compressed FASTA file with extension .fna called GCF_000005845.2_ASM584v2_genomic.fna that starts with:
>NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG
Using wcas in wc GCF_000005845.2_ASM584v2_genomic.fna gives 58022 lines, in Vimwe see that each line is 80 characters, except for the final one which is 52. So we have 58020 * 80 + 52 = 4641652 =~ 4.6 Mbp
64 bits is still too much address for current RAM sizes, so most architectures will use less bits.
x86_64 uses 48 bits (256 TiB), and legacy mode's PAE already allows 52-bit addresses (4 PiB). 56-bits is a likely future candidate.
12 of those 48 bits are already reserved for the offset, which leaves 36 bits.
If a2 level approach is taken, the best split would be two 18 bit levels.
But that would mean that the page directory would have 2^18 = 256K entries, which would take too much RAM: close to a single-level paging for 32 bit architectures!
Therefore, 64 bit architectures create even further page levels, commonly 3 or 4.
x86_64 uses4 levels in a 9 | 9 | 9 | 9 scheme, so that the upper level only takes up only 2^9 higher level entries.
The 48 bits are split equally into two disjoint parts:
----------------- FFFFFFFF FFFFFFFF
Top half
----------------- FFFF8000 00000000
Not addressable
----------------- 00007FFF FFFFFFFF
Bottom half
----------------- 00000000 00000000
The Linux kernel makes extensive usage of the paging features of x86 to allow fast process switches with small data fragmentation.
There are also however some features that the Linux kernel might not use, either because they are only for backwards compatibility, or because the Linuxdevs didn't feel it was worth it yet.
Facebook just clearly bought it to prevent it from actually growing further and killing facebook.
It is mindblowing that the sale wasn't cancelled due to anti trust.
The outcome of this is that WhatApp will remain with the same feature set forever, while other competitors have been growing, notably Discord and Slack.
youtu.be/uol4V1Wa8B0?t=1327 mentions the quadrangle architecture which served as the basis of the Colleges: make a closed square with everything students need: Chapel, Hall to eat, classes and accommodation. This is based of course on monastic cloisters.
