Ciro Santilli @cirosantilli 37

If the number of sections is greater than or equal to SHN_LORESERVE (0xff00), e_shnum has the value SHN_UNDEF (0) and the actual number of section header table entries is contained in the sh_size field of the section header at index 0 (otherwise, the sh_size member of the initial entry contains 0).

There are also other magic sections detailed in Figure 4-7: Special Section Indexes.

 Read the full article

ELF Hello World Tutorial / .shstrtab by

Ciro Santilli 37 Updated 2025-07-16

 View more

Section type: sh_type == SHT_STRTAB.

Common name: "section header string table".

The section name .shstrtab is reserved. The standard says:

This section holds section names.

This section gets pointed to by the e_shstrnd field of the ELF header itself.

String indexes of this section are are pointed to by the sh_name field of section headers, which denote strings.

This section does not have SHF_ALLOC marked, so it will not appear on the executing program.

readelf -x .shstrtab hello_world.o

outputs:

Hex dump of section '.shstrtab':
  0x00000000 002e6461 7461002e 74657874 002e7368 ..data..text..sh
  0x00000010 73747274 6162002e 73796d74 6162002e strtab..symtab..
  0x00000020 73747274 6162002e 72656c61 2e746578 strtab..rela.tex
  0x00000030 7400                                t.

The data in this section has a fixed format: www.sco.com/developers/gabi/2003-12-17/ch4.strtab.html

If we look at the names of other sections, we see that they all contain numbers, e.g. the .text section is number 7.

Then each string ends when the first NUL character is found, e.g. character 12 is \0 just after .text\0.

 Read the full article

ELF Hello World Tutorial / Standards by

Ciro Santilli 37 Updated 2025-07-16

 View more

ELF is specified by the LSB:

The LSB basically links to other standards with minor extensions, in particular:

Generic (both by SCO):
- System V ABI 4.1 (1997) www.sco.com/developers/devspecs/gabi41.pdf, no 64 bit, although a magic number is reserved for it. Same for core files. This is the first document you should look at when searching for information.
- System V ABI Update DRAFT 17 (2003) www.sco.com/developers/gabi/2003-12-17/contents.html, adds 64 bit. Only updates chapters 4 and 5 of the previous document: the others remain valid and are still referenced.
Architecture specific (by the processor vendor):
- IA-32: refspecs.linuxfoundation.org/LSB_4.1.0/LSB-Core-IA32/LSB-Core-IA32/elf-ia32.html, points mostly to www.sco.com/developers/devspecs/abi386-4.pdf
- AMD64: refspecs.linuxfoundation.org/LSB_4.1.0/LSB-Core-AMD64/LSB-Core-AMD64/elf-amd64.html, points mostly to www.x86-64.org/documentation/abi.pdf

A handy summary can be found at:

man elf

 Read the full article

Oil drop experiment by

Ciro Santilli 37 Updated 2025-07-16

 View more

Clear experiment diagram which explains that the droplet mass determined with Stoke's law:

Video 1.

Quantum Mechanics 4a - Atoms I by ViaScience (2013)

Source.

American Scientific, LLC sells a ready made educational kit for this: www.youtube.com/watch?v=EV3BtoMGA9c

Here's some actual footage of a droplet on a well described more one-off setup:

Video 2.

Millikan's Experiment, Part 2: The Experiment by Phil Furneaux (2017)

Source. From Lancaster University

This American video likely from the 60's shows it with amazing contrast: www.youtube.com/watch?v=_UDT2FcyeA4

 Read the full article

Ionizing and non-ionizing radiation by

Ciro Santilli 37 Updated 2025-07-16

 Read the full article

Visible spectrum by

Ciro Santilli 37 Updated 2025-07-16

 View more

420 to 680 nm for sure, but larger ranges are observable in laboratory conditions.

 Read the full article

E. Coli Whole Cell Model by Covert Lab / Run variants by

Ciro Santilli 37 Updated 2025-07-16

 View more

It would be boring if we could only simulate the same condition all the time, so let's have a look at the different boundary conditions that we can apply to the cell!

We are able to alter things like the composition of the external medium, and the genome of the bacteria, which will make the bacteria behave differently.

The variant selection is a bit cumbersome as we have to use indexes instead of names, but one you know what you are doing, it is fine.

Of course, genetic modification is limited only to experimentally known protein interactions due to the intractability of computational protein folding and computational chemistry in general, solving those would bsai.

 Read the full article

E. Coli K-12 MG1655 by

Ciro Santilli 37 Updated 2025-07-16

 View more

NCBI taxonomy entry: www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=511145 This links to:

genome: www.ncbi.nlm.nih.gov/genome/?term=txid511145 From there there are links to either:
- Download the FASTA: "Download sequences in FASTA format for genome, protein"
  For the genome, you get a compressed FASTA file with extension .fna called GCF_000005845.2_ASM584v2_genomic.fna that starts with:
  >NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG
  Using wc as in wc GCF_000005845.2_ASM584v2_genomic.fna gives 58022 lines, in Vim we see that each line is 80 characters, except for the final one which is 52. So we have 58020 * 80 + 52 = 4641652 =~ 4.6 Mbp
- Interactively browse the sequence on the browser viewer: "Reference genome: Escherichia coli str. K-12 substr. MG1655" which eventually leads to: www.ncbi.nlm.nih.gov/nuccore/556503834?report=graph
  If we zoom into the start, we hover over the very first gene/protein: the famous (just kidding) e. Coli K-12 MG1655 gene thrL, at position 190-255.
  The second one is the much more interesting e. Coli K-12 MG1655 gene thrA.
- Gene list, with a total of 4,629 as of 2021: www.ncbi.nlm.nih.gov/gene/?term=txid511145