E. Coli K-12 MG1655 operon thrLABC Updated +Created
We can find it by searching for the species in the BioCyc promoter database. This leads to: biocyc.org/group?id=:ALL-PROMOTERS&orgid=ECOLI.
By finding the first operon by position we reach: biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486.
That page lists several components of the promoter, which we should try to understand!
After the first gene in the codon, thrL, there is a rho-independent termination. By comparing:we understand that the presence of threonine or isoleucine variants, L-threonyl and L-isoleucyl, makes the rho-independent termination become more efficient, so the control loop is quite direct! Not sure why it cares about isoleucine as well though.
TODO which factor is actually specific to that DNA region?
E. Coli Whole Cell Model by Covert Lab Updated +Created
github.com/CovertLab/WholeCellEcoliRelease is a whole cell simulation model created by Covert Lab and other collaborators.
The project is written in Python, hurray! But according to te README, it seems to be the use a code drop model with on-request access to master, very meh, asked rationale on GitHub discussion, and they confirmed as expected that it is to:
  • to prevent their publication ideas from being stolen. Who would steal publication ideas with public proof in an issue tracker without crediting original authors?
  • to prevent noise from non collaborators. They do only get like 2 issues as year though, people forget that it is legal to ignore other people :-)
Oh well.
The project is a followup to the earlier M. genitalium whole cell model by Covert lab which modelled Mycoplasma genitalium. E. Coli has 8x more genes (500 vs 4k), but it the undisputed bacterial model organism and as such has been studied much more thoroughly. It also reproduces faster than Mycoplasma (20 minutes vs a few hours), which is a huge advantages for validation/exploratory experiments.
The project has a partial dependency on the proprietary optimization software CPLEX which is freeware, for students, not sure what it is used for exactly, from the comment in the requirements.txt the dependency is only partial.
This project makes Ciro Santilli think of the E. Coli as an optimization problem. Given such external nutrient/temperature condition, which DNA sequence makes the cell grow the fastest? Balancing metabolites feels like designing a Factorio speedrun.
There is one major thing missing thing in the current model: promoters/transcription factor interactions are not modelled due to lack/low quality of experimental data: github.com/CovertLab/WholeCellEcoliRelease/issues/21. They just have a magic direct "transcription factor to gene" relationship, encoded at reconstruction/ecoli/flat/foldChanges.tsv in terms of type "if this is present, such protein is expressed 10x more". Transcription units are not implemented at all it appears.
Everything in this section refers to version 7e4cc9e57de76752df0f4e32eca95fb653ea64e4, the code drop from November 2020, and was tested on Ubuntu 21.04 with a docker install of docker.pkg.github.com/covertlab/wholecellecolirelease/wcm-full with image id 502c3e604265, unless otherwise noted.
Condition Updated +Created
  • reconstruction/ecoli/flat/condition/nutrient/minimal.tsv contains the nutrients in a minimal environment in which the cell survives:
    "molecule id" "lower bound (units.mmol / units.g / units.h)" "upper bound (units.mmol / units.g / units.h)"
    "ADP[c]" 3.15 3.15
    "PI[c]" 3.15 3.15
    "PROTON[c]" 3.15 3.15
    "GLC[p]" NaN 20
    "OXYGEN-MOLECULE[p]" NaN NaN
    "AMMONIUM[c]" NaN NaN
    "PI[p]" NaN NaN
    "K+[p]" NaN NaN
    "SULFATE[p]" NaN NaN
    "FE+2[p]" NaN NaN
    "CA+2[p]" NaN NaN
    "CL-[p]" NaN NaN
    "CO+2[p]" NaN NaN
    "MG+2[p]" NaN NaN
    "MN+2[p]" NaN NaN
    "NI+2[p]" NaN NaN
    "ZN+2[p]" NaN NaN
    "WATER[p]" NaN NaN
    "CARBON-DIOXIDE[p]" NaN NaN
    "CPD0-1958[p]" NaN NaN
    "L-SELENOCYSTEINE[c]" NaN NaN
    "GLC-D-LACTONE[c]" NaN NaN
    "CYTOSINE[c]" NaN NaN
    If we compare that to reconstruction/ecoli/flat/condition/nutrient/minimal_plus_amino_acids.tsv, we see that it adds the 20 amino acids on top of the minimal condition:
    "L-ALPHA-ALANINE[p]" NaN NaN
    "ARG[p]" NaN NaN
    "ASN[p]" NaN NaN
    "L-ASPARTATE[p]" NaN NaN
    "CYS[p]" NaN NaN
    "GLT[p]" NaN NaN
    "GLN[p]" NaN NaN
    "GLY[p]" NaN NaN
    "HIS[p]" NaN NaN
    "ILE[p]" NaN NaN
    "LEU[p]" NaN NaN
    "LYS[p]" NaN NaN
    "MET[p]" NaN NaN
    "PHE[p]" NaN NaN
    "PRO[p]" NaN NaN
    "SER[p]" NaN NaN
    "THR[p]" NaN NaN
    "TRP[p]" NaN NaN
    "TYR[p]" NaN NaN
    "L-SELENOCYSTEINE[c]" NaN NaN
    "VAL[p]" NaN NaN
    so we guess that NaN in the upper mound likely means infinite.
    We can try to understand the less obvious ones:
    • ADP: TODO
    • PI: TODO
    • PROTON[c]: presumably a measure of pH
    • GLC[p]: glucose, this can be seen by comparing minimal.tsv with minimal_no_glucose.tsv
    • AMMONIUM: ammonium. This appears to be the primary source of nitrogen atoms for producing amino acids.
    • CYTOSINE[c]: hmmm, why is external cytosine needed? Weird.
  • reconstruction/ecoli/flat/reconstruction/ecoli/flat/condition/timeseries/` contains sequences of conditions for each time. For example:
    * 
    reconstruction/ecoli/flat/reconstruction/ecoli/flat/condition/timeseries/000000_basal.tsv contains: "time (units.s)" "nutrients" 0 "minimal" which means just using reconstruction/ecoli/flat/condition/nutrient/minimal.tsv until infinity. That is the default one used by runSim.py, as can be seen from ./out/manual/wildtype_000000/000000/generation_000000/000000/simOut/Environment/attributes/nutrientTimeSeriesLabel which contains just 000000_basal. * reconstruction/ecoli/flat/reconstruction/ecoli/flat/condition/timeseries/000001_cut_glucose.tsv is more interesting and contains:
      "time (units.s)" "nutrients"
      0 "minimal"
      1200 "minimal_no_glucose"
      
    so we see that this will shift the conditions half-way to a condition that will eventually kill the bacteria because it will run out of glucose and thus energy!
    Timeseries can be selected with --variant nutrientTimeSeries X Y, see also: run variants.
    We can use that variant with:
      VARIANT="condition" FIRST_VARIANT_INDEX=1 LAST_VARIANT_INDEX=1 python runscripts/manual/runSim.py
      
  • reconstruction/ecoli/flat/condition/condition_defs.tsv contains lines of form:
    "condition" "nutrients"                "genotype perturbations" "doubling time (units.min)" "active TFs"
    "basal"     "minimal"                  {}                       44.0                        []
    "no_oxygen" "minimal_minus_oxygen"     {}                       100.0                       []
    "with_aa"   "minimal_plus_amino_acids" {}                       25.0                        ["CPLX-125", "MONOMER0-162", "CPLX0-7671", "CPLX0-228", "MONOMER0-155"]
    • condition refers to entries in reconstruction/ecoli/flat/condition/condition_defs.tsv
    • nutrients refers to entries under reconstruction/ecoli/flat/condition/nutrient/, e.g. reconstruction/ecoli/flat/condition/nutrient/minimal.tsv or reconstruction/ecoli/flat/condition/nutrient/minimal_plus_amino_acids.tsv
    • genotype perturbations: there aren't any in the file, but this suggests that genotype modifications can also be incorporated here
    • doubling time: TODO experimental data? Because this should be a simulation output, right? Or do they cheat and fix doubling by time?
    • active TFs: this suggests that they are cheating transcription factors here, as those would ideally be functions of other more basic inputs
Source code overview Updated +Created
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
    "n" "CCO-BAC-NUCLEOID"
    "j" "CCO-CELL-PROJECTION"
    "w" "CCO-CW-BAC-NEG"
    "c" "CCO-CYTOSOL"
    "e" "CCO-EXTRACELLULAR"
    "m" "CCO-MEMBRANE"
    "o" "CCO-OUTER-MEM"
    "p" "CCO-PERI-BAC"
    "l" "CCO-PILUS"
    "i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
    148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
    [91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
    • aaCount: amino acid count, how many of each of the 20 proteinogenic amino acid are there
    • seq: full sequence, using the single letter abbreviation of the proteinogenic amino acids
    • mw; molecular weight? The 11 components appear to be given at reconstruction/ecoli/flat/scripts/unifyBulkFiles.py:
      molecular_weight_keys = [
        '23srRNA',
        '16srRNA',
        '5srRNA',
        'tRNA',
        'mRNA',
        'miscRNA',
        'protein',
        'metabolite',
        'water',
        'DNA',
        'RNA' # nonspecific RNA
        ]
      so they simply classify the weight? Presumably this exists for complexes that have multiple classes?
    • location: cell compartment where the protein is present, c defined at reconstruction/ecoli/flat/compartments.tsv as cytoplasm, as expected for something that will make an amino acid
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
    174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
    • halfLife: half-life
    • mw: molecular weight, same as in reconstruction/ecoli/flat/proteins.tsv. This molecule only have weight in the mRNA class, as expected, as it just codes for a protein
    • location: same as in reconstruction/ecoli/flat/proteins.tsv
    • ntCount: nucleotide count for each of the ATGC
    • microarray expression: presumably refers to DNA microarray for gene expression profiling, but what measure exactly?
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
    AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
    0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
    657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
    66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
    2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
    "HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    "L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
      {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
      {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
    "complexation"
      [
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
          "coeff": 1,
          "type": "proteincomplex",
          "location": "c",
          "form": "mature"
        },
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
          "coeff": -4,
          "type": "proteinmonomer",
          "location": "c",
          "form": "mature"
        }
      ]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
    "aspartate kinase / homoserine dehydrogenase"
    ""
    [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
    ["c"]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    "ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
    "arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
    "fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
    "dksA" "EG10230"