Linux insides by Ciro Santilli 40 Updated 2025-07-16
Documents the Linux kernel. Somewhat of a competitor to Linux Kernel Module Cheat, but more wordy and less automated.
It would be boring if we could only simulate the same condition all the time, so let's have a look at the different boundary conditions that we can apply to the cell!
We are able to alter things like the composition of the external medium, and the genome of the bacteria, which will make the bacteria behave differently.
The variant selection is a bit cumbersome as we have to use indexes instead of names, but one you know what you are doing, it is fine.
Of course, genetic modification is limited only to experimentally known protein interactions due to the intractability of computational protein folding and computational chemistry in general, solving those would bsai.
The default run variant, if you don't pass any options, just has the minimal growth conditions set. What this means can be seen at condition.
Notably, this implies a growth medium that includes glucose and salt. It also includes oxygen, which is not strictly required, but greatly benefits cell growth, and is of course easier to have than not have as it is part of the atmosphere!
But the medium does not include amino acids, which the bacteria will have to produce by itself.
To modify the nutrients as a function of time, with To select a time series we can use something like:
python runscripts/manual/runSim.py --variant nutrientTimeSeries 25 25
As mentioned in python runscripts/manual/runSim.py --help, nutrientTimeSeries is one of the choices from github.com/CovertLab/WholeCellEcoliRelease/blob/7e4cc9e57de76752df0f4e32eca95fb653ea64e4/models/ecoli/sim/variants/__init__.py#L57
25 25 means to start from index 25 and also end at 25, so running just one simulation. 25 27 would run 25 then 26 and then 27 for example.
The timeseries with index 25 is reconstruction/ecoli/flat/condition/timeseries/000025_cut_aa.tsv and contains
"time (units.s)" "nutrients"
0 "minimal_plus_amino_acids"
1200 "minimal"
so we understand that it starts with extra amino acids in the medium, which benefit the cell, and half way through those are removed at time 1200s = 20 minutes. We would therefore expect the cell to start expressing amino acid production genes exactly at that point.
nutrients likely means condition in that file however, see bug report with 1 1 failing: github.com/CovertLab/WholeCellEcoliRelease/issues/24
When we do this the simulation ends in:
Simulation finished:
 - Length: 0:34:23
 - Runtime: 0:08:03
so we see that the doubling time was faster than the one with minimal conditions of 0:42:49, which makes sense, since during the first 20 minutes the cell had extra amino acid nutrients at its disposal.
The output directory now contains simulation output data under out/manual/nutrientTimeSeries_000025/. Let's run analysis and plots for that:
python runscripts/manual/analysisVariant.py &&
python runscripts/manual/analysisCohort.py --variant 25 &&
python runscripts/manual/analysisMultigen.py --variant 25 &&
python runscripts/manual/analysisSingle.py --variant 25
We can now compare the outputs of this run to the default wildtype_000000 run from Section "Install and first run".
  • out/manual/plotOut/svg_plots/massFractionSummary.svg: because we now have two variants in the same out/ folder, wildtype_000000 and nutrientTimeSeries_000025, we now see a side by side comparision of both on the same graph!
    The run variant where we started with amino acids initially grows faster as expected, because the cell didn't have to make it's own amino acids, so growth is a bit more efficient.
    Then, at 20 minutes, which is about 0.3 hours, we see that the cell starts growing a bit less fast as the slope of the curve decreases a bit, because we removed that free amino acid supply.
    Figure 1.
    Minimal condition vs amino acid cut mass fraction plot
    . Source. From file out/manual/plotOut/svg_plots/massFractionSummary.svg.
The following plots from under out/manual/wildtype_000000/000000/{generation_000000,nutrientTimeSeries_000025}/000000/plotOut/svg_plots have been manually joined side-by-side with:
for f in out/manual/wildtype_000000/000000/generation_000000/000000/plotOut/svg_plots/*; do
  echo $f
  svg_stack.py \
    --direction h \
    out/manual/wildtype_000000/000000/generation_000000/000000/plotOut/svg_plots/$(basename $f) \
    out/manual/nutrientTimeSeries_000025/000000/generation_000000/000000/plotOut/svg_plots/$(basename $f) \
    > tmp/$(basename $f)
done
Figure 2.
Amino acid counts
. Source. aaCounts.svg:
  • default: quantities just increase
  • amino acid cut: there is an abrupt fall at 20 minutes when we cut off external supply, presumably because it takes some time for the cell to start producing its own
Figure 3.
External exchange fluxes of amino acids
. Source. aaExchangeFluxes.svg:
  • default: no exchanges
  • amino acid cut: for all graphs except phenylalanine (PHE), either the cell was intaking the AA (negative flux), and that intake goes to 0 when the supply is cut, or the flux is always 0.
    For PHE however, the flux is at all times, except shortly after the cut. Why? And why there was no excretion on the default conditions?
Figure 4. . Source. evaluationTime.svg: this has nothing to do with biology, but it is rather a profile of the program runtime. We can see that the simulation gets slower and slower as time passes, presumably because there are more and more molecules to simulate.
Figure 5.
mRNA count of highly expressed mRNAs
. Source. From file expression_rna_03_high.svg. Each of the entries is a gene using the conventional gene naming convention of xyzW, e.g. here's the BioCyc for the first entry, tufA: biocyc.org/gene?orgid=ECOLI&id=EG11036, which comments
Elongation factor Tu (EF-Tu) is the most abundant protein in E. coli.
and
In E. coli, EF-Tu is encoded by two genes, tufA and tufB
. What they seem to mean is that tufA and tufB are two similar molecules, either of which can make up the EF-Tu of the E. Coli, which is an important part of translation.
Figure 6.
External exchange fluxes
. Source.
mediaExcange.svg: this one is similar to aaExchangeFluxes.svg, but it also tracks other substances. The color version makes it easier to squeeze more substances in a given space, but you lose the shape of curves a bit. The title seems reversed: red must be excretion, since that's where glucose (GLC) is.
The substances are different between the default and amino acid cut graphs, they seem to be the most exchanged substances. On the amino cut graph, first we see the cell intaking most (except phenylalanine, which is excreted for some reason). When we cut amino acids, the uptake of course stops.
Besides time series run variants, conditions can also be selected directly without a time series as in:
python runscripts/manual/runSim.py --variant condition 1 1
which select row indices from reconstruction/ecoli/flat/condition/condition_defs.tsv. The above 1 1 would mean the second line of that file which starts with:
"condition" "nutrients" "genotype perturbations" "doubling time (units.min)" "active TFs"
"basal" "minimal" {} 44.0 []
"no_oxygen" "minimal_minus_oxygen" {} 100.0 []
"with_aa" "minimal_plus_amino_acids" {} 25.0 ["CPLX-125", "MONOMER0-162", "CPLX0-7671", "CPLX0-228", "MONOMER0-155"]
so 1 means no_oxygen.
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
    "n" "CCO-BAC-NUCLEOID"
    "j" "CCO-CELL-PROJECTION"
    "w" "CCO-CW-BAC-NEG"
    "c" "CCO-CYTOSOL"
    "e" "CCO-EXTRACELLULAR"
    "m" "CCO-MEMBRANE"
    "o" "CCO-OUTER-MEM"
    "p" "CCO-PERI-BAC"
    "l" "CCO-PILUS"
    "i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
    148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
    [91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
    174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
    AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
    0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
    657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
    66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
    2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
    "HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    "L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
      {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
      {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
    "complexation"
      [
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
          "coeff": 1,
          "type": "proteincomplex",
          "location": "c",
          "form": "mature"
        },
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
          "coeff": -4,
          "type": "proteinmonomer",
          "location": "c",
          "form": "mature"
        }
      ]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
    "aspartate kinase / homoserine dehydrogenase"
    ""
    [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
    ["c"]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    "ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
    "arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
    "fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
    "dksA" "EG10230"
As of 2020, no one knows how to build the major desktop distros fully from source into the ISO, and especially so in a reproducible build way. Everything is done in build servers somewhere with complicated layers of prebuilds. It's crap.
Snap (package manager) by Ciro Santilli 40 Updated 2025-07-16
merlijn.sebrechts.be/blog/2020-08-02-why-one-snap-store/ has some very good comments on how snap is more closed than Flatpak.
Snap's permission system is extremely annoying, notably restricting access to home files. They need a popup that says "permission required by app, accept?" urgently!!!
Ubuntu by Ciro Santilli 40 Updated 2025-07-16
Ciro Santilli's Linux distro of choice as of 2019.
It ain't perfect, but it's decent enough.
The greatest advantage of it being that it has the likely largest desktop user base, and therefore the highest likelihood that your problems are solved on Ask Ubuntu, and goes together with Ciro's philosophy that "people should do everything in the same way to factor stuff out", especially the open source losers.
Ciro considers that the killer flaw of Ubuntu, and most desktop distros of 2020, is that no one under the Sun knows how to build them fully from source: Linux distribution buildable from source. This is why Ciro based the Linux Kernel Module Cheat on Buildroot, see also: Linux distribution buildable from source.

Pinned article: Introduction to the OurBigBook Project

Welcome to the OurBigBook Project! Our goal is to create the perfect publishing platform for STEM subjects, and get university-level students to write the best free STEM tutorials ever.
Everyone is welcome to create an account and play with the site: ourbigbook.com/go/register. We belive that students themselves can write amazing tutorials, but teachers are welcome too. You can write about anything you want, it doesn't have to be STEM or even educational. Silly test content is very welcome and you won't be penalized in any way. Just keep it legal!
We have two killer features:
  1. topics: topics group articles by different users with the same title, e.g. here is the topic for the "Fundamental Theorem of Calculus" ourbigbook.com/go/topic/fundamental-theorem-of-calculus
    Articles of different users are sorted by upvote within each article page. This feature is a bit like:
    • a Wikipedia where each user can have their own version of each article
    • a Q&A website like Stack Overflow, where multiple people can give their views on a given topic, and the best ones are sorted by upvote. Except you don't need to wait for someone to ask first, and any topic goes, no matter how narrow or broad
    This feature makes it possible for readers to find better explanations of any topic created by other writers. And it allows writers to create an explanation in a place that readers might actually find it.
    Figure 1.
    Screenshot of the "Derivative" topic page
    . View it live at: ourbigbook.com/go/topic/derivative
  2. local editing: you can store all your personal knowledge base content locally in a plaintext markup format that can be edited locally and published either:
    This way you can be sure that even if OurBigBook.com were to go down one day (which we have no plans to do as it is quite cheap to host!), your content will still be perfectly readable as a static site.
    Figure 2.
    You can publish local OurBigBook lightweight markup files to either https://OurBigBook.com or as a static website
    .
    Figure 3.
    Visual Studio Code extension installation
    .
    Figure 4.
    Visual Studio Code extension tree navigation
    .
    Figure 5.
    Web editor
    . You can also edit articles on the Web editor without installing anything locally.
    Video 3.
    Edit locally and publish demo
    . Source. This shows editing OurBigBook Markup and publishing it using the Visual Studio Code extension.
    Video 4.
    OurBigBook Visual Studio Code extension editing and navigation demo
    . Source.
  3. https://raw.githubusercontent.com/ourbigbook/ourbigbook-media/master/feature/x/hilbert-space-arrow.png
  4. Infinitely deep tables of contents:
    Figure 6.
    Dynamic article tree with infinitely deep table of contents
    .
    Descendant pages can also show up as toplevel e.g.: ourbigbook.com/cirosantilli/chordate-subclade
All our software is open source and hosted at: github.com/ourbigbook/ourbigbook
Further documentation can be found at: docs.ourbigbook.com
Feel free to reach our to us for any help or suggestions: docs.ourbigbook.com/#contact