Has some good mentions, but often leaves you wanting more details of how certain things happened, especially the early days stuff.
Does however paint agood picture of several notable employees, and non-search projects from the early 2000's including:
the cook dude
porn cookie guy
the unusual IPO process
Paints a very positive picture of the founders. It is likely true. They gave shares generously to early employees. Tried to allow the more general public to buy from IPO, by using abidding scheme, rather than focusing on the big bankers as was usual.
The book gives good highlight as to why Google became big: search was just an incredibly computationally intensive task. From very early days, Largey were already making up their own somewhat custom compute systems from very early days, which naturally led into Google custom hardware later on. Google just managed to pull ahead on the reinvest revenue into hardware loop, and no one ever caught them back. This feels more the case than e.g. with Amazon, which notoriously had to buy off dozens of competitors to clear the way.
If the number of sections is greater than or equal to SHN_LORESERVE (0xff00), e_shnum has the value SHN_UNDEF (0) and the actual number of section header table entries is contained in the sh_size field of the section header at index 0 (otherwise, the sh_size member of the initial entry contains 0).
There are also other magic sections detailed in Figure 4-7: Special Section Indexes.
It would be boring if we could only simulate the same condition all the time, so let's have a look at the different boundary conditions that we can apply to the cell!
We are able to alter things like the composition of the external medium, and the genome of the bacteria, which will make the bacteria behave differently.
The variant selection is abit cumbersome aswe have to use indexes instead of names, but one you know what you are doing, it is fine.
For the genome, you get a compressed FASTA file with extension .fna called GCF_000005845.2_ASM584v2_genomic.fna that starts with:
>NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG
Using wcas in wc GCF_000005845.2_ASM584v2_genomic.fna gives 58022 lines, in Vimwe see that each line is 80 characters, except for the final one which is 52. So we have 58020 * 80 + 52 = 4641652 =~ 4.6 Mbp
Ciro Santilli 35 Updated 2025-04-18 +Created 1970-01-01