UniProt for example describes YaaX as "Uncharacterized protein YaaX".
As function is discovered, they then change it to a better name, e.g. to names such as the E. Coli K-12 MG1655 transcription unit thrLABC proteins all of which have a clear name due to threonine.
There are many other y??? as of 2021! Though they do tend to be smaller molecules.
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
    "n" "CCO-BAC-NUCLEOID"
    "j" "CCO-CELL-PROJECTION"
    "w" "CCO-CW-BAC-NEG"
    "c" "CCO-CYTOSOL"
    "e" "CCO-EXTRACELLULAR"
    "m" "CCO-MEMBRANE"
    "o" "CCO-OUTER-MEM"
    "p" "CCO-PERI-BAC"
    "l" "CCO-PILUS"
    "i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
    148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
    [91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
    174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
    AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
    0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
    657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
    66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
    2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
    "HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    "L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
      {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
      {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
    "complexation"
      [
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
          "coeff": 1,
          "type": "proteincomplex",
          "location": "c",
          "form": "mature"
        },
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
          "coeff": -4,
          "type": "proteinmonomer",
          "location": "c",
          "form": "mature"
        }
      ]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
    "aspartate kinase / homoserine dehydrogenase"
    ""
    [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
    ["c"]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    "ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
    "arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
    "fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
    "dksA" "EG10230"
Molecular beam Created 2024-11-15 Updated 2025-07-16
Molecular beams are cool because they create a one dimensional flow of molecules, which makes it easier to observe certain single-molecule effects, as it removes the multi-particle issues from experiments.
The center piece of the control system of atomic clocks is a molecular beam.
Omics Updated 2026-08-21
Each of the omics studies a subset of molecular biology with a data intensive and broad point of view that tries to understand global function or organisms, trying to understand what every biologically relevant molecule does as part of the hole metabolism.
Omics might be stamp collecting, but maybe it is a bit more like Trading card game/Magic: The Gathering collecting, in which the cards that you are collecting actually have specific uses and interactions, especially considering that most metabolic pathways are analogous across many species.
Figure 1.
Hierarchical diagram of the major omics
. Source.
Quantum chemistry Updated 2025-07-16
Ah, the jewel of computational physics.
Also known as an ab initio method: no experimental measurement is taken as input, QED is all you need.
But since QED is thought to fully describe all relevant aspects molecules, it could be called "the" ab initio method.
For one, if we were able to predict protein molecule interactions, our understanding of molecular biology technologies would be solved.
No more ultra expensive and complicated X-ray crystallography or cryogenic electron microscopy.
And the fact that quantum computers are one of the most promising advances to this field, is also very very exciting: Section "Quantum algorithm".