The conventional starting point is not at the E. Coli K-12 MG1655 origin of replication.
biocyc.org/ECOLI/NEW-IMAGE?type=EXTRAGENIC-SITE&object=G0-10506 explains:
This site is the origin of replication of the E. coli chromosome. It contains the binding sites for DnaA, which is critical for initiation of replication. Replication proceeds bidirectionally. For historical reasons, the numbering of E. coli's circular chromosome does not start at the origin of replication, but at the origin of transfer during conjugation.
If it is a bit hard to understand what they mean by "origin of transfer" though, as that term is usually associated with the origin of transfer of bacterial conjugation.
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
    "n" "CCO-BAC-NUCLEOID"
    "j" "CCO-CELL-PROJECTION"
    "w" "CCO-CW-BAC-NEG"
    "c" "CCO-CYTOSOL"
    "e" "CCO-EXTRACELLULAR"
    "m" "CCO-MEMBRANE"
    "o" "CCO-OUTER-MEM"
    "p" "CCO-PERI-BAC"
    "l" "CCO-PILUS"
    "i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
    148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
    [91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
    174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
    AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
    0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
    657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
    66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
    2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
    "HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    "L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
      {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
      {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
    "complexation"
      [
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
          "coeff": 1,
          "type": "proteincomplex",
          "location": "c",
          "form": "mature"
        },
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
          "coeff": -4,
          "type": "proteinmonomer",
          "location": "c",
          "form": "mature"
        }
      ]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
    "aspartate kinase / homoserine dehydrogenase"
    ""
    [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
    ["c"]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    "ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
    "arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
    "fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
    "dksA" "EG10230"
www.newyorker.com/magazine/2022/03/07/a-journey-to-the-center-of-our-cells A Journey to the Center of Our Cells (2022) by James Somers comments on M. genitalium in general, and in particular on the JCVI strains.
JCVI-syn3A by Ciro Santilli 37 Updated 2025-07-16
essential metabolism for a minimal cell (2019) mentions:
JCVI-syn3A, a robust minimal cell with a 543 kbp genome and 493 genes, provides a versatile platform to study the basics of life.
Based on JCVI-syn3.0, they've added a few genes back to give better phenotypes, including slightly faster duplication time. Because the development cycle time is your God is also true in biology.
As of essential metabolism for a minimal cell (2019) it had only 91 genes of unknown function! So funny.
Bibliograpy:
Figure 1.
JCVI-syn3A during cell division by David Goodsell (2022)
Source. A description is present at: cdn.rcsb.org/pdb101/goodsell/2022_JCVI-syn3A.pdf Integrative Illustration of a JCVI-syn3A Minimal Cell by David Goodsell (2022) which describes everything in the picture.
Chordate by Ciro Santilli 37 Updated 2025-07-16
Chordate is a sad clade.
You read the name and think: hmm, neural cords!
But then you see that his is one of its members:
Yup. That's your cousin. And it's a much closer cousin than something like arthropods, which at least have heads eyes and legs like you.
Fish by Ciro Santilli 37 Updated 2025-07-16
This paraphyletic subgroup is easy to form the "acquatic only" (fishes) vs "things that come out of water" (tetrapods). Though mudfishes make that distinction harder.
Which kind of makes sense, why would you want for limbs unless you are going to stay out of water!
Synapsid by Ciro Santilli 37 Updated 2025-07-16
Mammals and a bunch of extinct animals that look more like mammals than reptiles.
TODO name: Wikipedia says "being with a fused arch" but what does that mean???
Bat by Ciro Santilli 37 Updated 2025-07-16
As of 2020, account for about 20% of the known mammal species!!! www.sciencefocus.com/nature/why-are-there-so-many-species-of-bat/ mentions some reasons:
  • they can fly, so they can move out further
  • their eating habits are highly specialized
Rat by Ciro Santilli 37 Updated 2025-07-16
Since rat and mouse are not scientifically specific names, we'll just use them interchangeably.
When one specific species is implied, we will mean Mus musculus by default.
Human loss of fur by Ciro Santilli 37 Updated 2025-07-16
Video 1.
How Humans Lost Their Fur by PBS Eons (2020)
Source. Says it is linked to bipedalism to help hunting in hot weather. But could only happen fully after the invention of fire, otherwise you'd be too cold at night.

Pinned article: Introduction to the OurBigBook Project

Welcome to the OurBigBook Project! Our goal is to create the perfect publishing platform for STEM subjects, and get university-level students to write the best free STEM tutorials ever.
Everyone is welcome to create an account and play with the site: ourbigbook.com/go/register. We belive that students themselves can write amazing tutorials, but teachers are welcome too. You can write about anything you want, it doesn't have to be STEM or even educational. Silly test content is very welcome and you won't be penalized in any way. Just keep it legal!
We have two killer features:
  1. topics: topics group articles by different users with the same title, e.g. here is the topic for the "Fundamental Theorem of Calculus" ourbigbook.com/go/topic/fundamental-theorem-of-calculus
    Articles of different users are sorted by upvote within each article page. This feature is a bit like:
    • a Wikipedia where each user can have their own version of each article
    • a Q&A website like Stack Overflow, where multiple people can give their views on a given topic, and the best ones are sorted by upvote. Except you don't need to wait for someone to ask first, and any topic goes, no matter how narrow or broad
    This feature makes it possible for readers to find better explanations of any topic created by other writers. And it allows writers to create an explanation in a place that readers might actually find it.
    Figure 1.
    Screenshot of the "Derivative" topic page
    . View it live at: ourbigbook.com/go/topic/derivative
  2. local editing: you can store all your personal knowledge base content locally in a plaintext markup format that can be edited locally and published either:
    This way you can be sure that even if OurBigBook.com were to go down one day (which we have no plans to do as it is quite cheap to host!), your content will still be perfectly readable as a static site.
    Figure 5. . You can also edit articles on the Web editor without installing anything locally.
    Video 3.
    Edit locally and publish demo
    . Source. This shows editing OurBigBook Markup and publishing it using the Visual Studio Code extension.
  3. https://raw.githubusercontent.com/ourbigbook/ourbigbook-media/master/feature/x/hilbert-space-arrow.png
  4. Infinitely deep tables of contents:
    Figure 6.
    Dynamic article tree with infinitely deep table of contents
    .
    Descendant pages can also show up as toplevel e.g.: ourbigbook.com/cirosantilli/chordate-subclade
All our software is open source and hosted at: github.com/ourbigbook/ourbigbook
Further documentation can be found at: docs.ourbigbook.com
Feel free to reach our to us for any help or suggestions: docs.ourbigbook.com/#contact