Ciro Santilli @cirosantilli 40

Stanford, MIT, Harvard and Oxford are luxury goods in the same sense that a Mercedes-Benz might be, or the latest iPhone. They sell an aesthetic experience that provides the consumer with social status, similar to acquiring expensive clothes or a fancy house.

Video 1.

Bar scene from Good Will Hunting

. Source. This scene is way way overdone. But:

Hero: You wasted $150,000 on an education you coulda got for $1.50 in late fees at the public library.
Bad guy: Yeah, but I will have a degree. And you'll be serving my kids fries at a drive-through on our way to a skiing trip.

 Read the full article

Joan Feynman Updated 2025-07-16

 View more

Video 1.

My brother, Richard: How he came to be so smart interview with Joan Feynman by Web of Stories (2019)

Source. Ah, shame to see Joan so old. Some good stories. The tiles game thing was not mentioned in Genius: Richard Feynman and Modern Physics by James Gleick (1994) I think.

 Read the full article

Jazz fusion musician Updated 2025-07-16

 View more

Ciro Santilli's favorites, including album when they're more of a one hit wonder:

 Read the full article

University is broken Updated 2025-07-16

 View more

You just have to spend a few minutes with students until they complain about the courses or teachers. And you just have to spend a few hours with teachers until they complain about the students or broader system.

University is broken, and everyone knows it. The only question now is finding a viable, "political cash flow positive" path, into something better.

Bibliography:

academeblog.org/2022/10/05/american-universities-are-going-to-implode/ American Universities Are Going to Implode (2022) by www.linkedin.com/in/jsgabin/
theimaginativeconservative.org/2020/04/higher-education-implode-alexander-zubatov.html Higher Education Is About to Implode by Alexander Zubatov (2020)
2024-05-28 www.theguardian.com/education/article/2024/may/28/i-see-little-point-uk-university-students-on-why-attendance-has-plummeted ‘I see little point’: UK university students on why attendance has plummeted
"There’s a bit of a feeling that there is just box-ticking going on [among students], and getting a degree at the end of it."
Give it to me, baby. OurBigBook incoming.

 Read the full article

Unmigrated sections of the old version of Ciro Santilli's website Updated 2025-07-16

 View more

It is interesting to see how your own ideas shift with time, and Ciro Santilli doesn't think the following are very important anymore, so he was lazy to migrate them.

When he did the original website Ciro was in a "I must show off my skills to get a job mindset", but then after he landed a few jobs he moved to a "CV websites are useless, just do amazing projects and showcase them on your website to help them succeed" mindset.

 Read the full article

ELF Hello World Tutorial / Minimal ELF file Updated 2025-07-16

 View more

It is non-trivial to determine what is the smallest legal ELF file, or the smaller one that will do something trivial in Linux.

Some impressive attempts:

In this example we will consider a saner hello world example that will better capture real life cases.

 Read the full article

Jazz fusion Updated 2025-07-16

 View more

Ciro Santilli's favorite music genre.

Ciro's 2020 perfect Friday evening: jazz fusion + study quantum field theory on an Amazon Kindle. Ahhhhhh.

 Read the full article

Elementary charge Updated 2025-07-16

 View more

Experiments to measure it:

oil drop experiment

The 2019 redefinition of the SI base units defines it precisely and uses it as a measure of charge: en.wikipedia.org/wiki/2019_redefinition_of_the_SI_base_units#Ampere

 Read the full article

Electroweak interaction Updated 2025-07-16

 View more

Video 1.

Electroweak Theory and the Origin of the Fundamental Forces by PBS Space Time (2020)

Source. Unsatisfactory, as usual.

 Read the full article

United States Updated 2025-07-16

 View more

The ruler of the 1950-2020 world by Dollar and nuke count.

Capable of evil like any other country, and somewhat merciless to its poor and overly egocentric, but not nearly as evil as any dictatorship.

Has the huge advantage of being one large country which speaks English.

Countries of the world have only two choices as of 2019: either rally behind the US and support democracy, or rally behind China and support dictatorship. The choice is up to you, voters. The more you deal with China, the more you lose your democracy and freedom. All dictatorships have no doubt that they must stick together.

And Americans, please stop that America Number 1 bullshit. Obviously everyone has to strive to be the best, so when you say it like that, it sounds like "even if at the expense of everyone else". The motto has to be "democracy number 1" or else you will scare off all allies. If all other countries sell out to China, you are fucked.

 Read the full article

Tinker Tailor Soldier Spy (TV series) Updated 2025-07-16

 View more

1: Jim Prideaux captured. Some ex-colleague invites Smiley to dinner and keeps asking how incompetent people like Alleline climbed to the top of the Circus. Smiley recalled to service to meet Ricki Tarr.
2: Ricki Tarr tells his story to Smiley. Peter Guillam starts stealing material from the Circus, find missing page on the communication officer list. Smiley sets up his investigation operation.
3: Smiley meets Connie who tells that she was fired for suspecting Poliakov. Flashbacks show the ousting of Control and Smiley.
4: Guillam steals more material from the circus. While doing that, he is called by the top officers to inquire about Ricki Tarr being in England, which they suspect because they discovered that his family has come.
5: Jim Prideaux tells his story to Smiley, who cannot easily access the Circus reports about it. When he is returned to England, there was basically no debriefing, and Esterhase already knew about the Tinker Tailor codenames, presumably through Merlin.
6: Smiley hears the story of yet another ousted man, who heard the Russians knew in advance about Jim Prideaux' coming. Toby Esterhase dismissed him for alcoholism.

 Read the full article

Electronic component Updated 2025-07-16

 View more

Video 1.

Open Circuits book interview by CuriousMarc (2022)

Source.

 Read the full article

E-learning websites must keep content free, only charge for certification Updated 2025-07-16

 View more

Charging for certification is fine. Creating exams and preventing cheating has a cost.

Another thing that is fine charging for is dedicated 1-to-1 tutor time. This is something Udacity is doing as of 2022.

www.investopedia.com/articles/investing/042815/how-coursera-works-makes-money.asp has a good mention:

MOOCs were first created by people with utopian visions for the internet. This means the idea for platforms like Coursera was likely conceived without a business plan in mind. Nonetheless, Coursera has managed to monetize its platform. It is worth noting, however, that monetization has lead to the effective elimination of the original MOOC idea, which is predicated on ideals like free and open access, as well as the building of online communities.
Coursera users must pay to engage with the material in a meaningful way and take courses for individualistic purposes. This has been a consistent trend among all major online education platforms.

and it links to: www.freecodecamp.org/news/massive-open-online-courses-started-out-completely-free-but-where-are-they-now-1dd1020f59/, very good article!

That is a fundamental guiding principle of OurBigBook.com. The educational content must be licensed CC BY-SA!

Perhaps the most reliable way of reaching this state is E-learning websites must allow students to create learning content.

Bibliography:

academia.stackexchange.com/questions/86179/is-it-financially-worth-it-to-teach-a-mooc-e-g-coursera Is it financially worth it to teach a MOOC (e.g. Coursera)?
www.classcentral.com/about amazing, they can make money just from ads! I wouldn't expect that they could scale like TripAdvisor, because travelling means very local knowledge, I would expect there to be much fewer MOOCs and for them to be more easily findable on Google. Good thing though, this website.

 Read the full article

E-learning Updated 2025-07-16

 View more

See also: e-learning website.

 Read the full article

Einstein notation for partial derivatives Updated 2025-07-16

 View more

The Einstein summation convention works will with partial derivatives and it is widely used in particle physics.

In particular, the divergence and the Laplacian can be succinctly expressed in this notation:

In order to express partial derivatives, we must use what Ciro Santilli calls the "partial index partial derivative notation", which refers to variables with indices such as

x_{0}

x_{1}

x_{2}

\partial_{0}

\partial_{1}

and

\partial_{2}

instead of the usual letters

x

y

and

z

 Read the full article

Eightfold way (physics) Updated 2025-07-16

 View more

Video 1.

Strangeness Minus Three (BBC Horizon 1964)

Source. Basically shows Richard Feynman 15 minutes on a blackboard explaining the experimental basis of the eightfold way really well, while at the same time hyperactively moving all over. The word symmetry gets tossed a few times.

 Read the full article

James Somers Updated 2025-07-16

 View more

Huge interest overlap with Ciro Santilli, e.g. he's into

 Read the full article

E. Coli Whole Cell Model by Covert Lab / Source code overview Updated 2025-07-16

 View more

The key model database is located in the source code at reconstruction/ecoli/flat.

Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".

We'll realize that a lot of data and IDs come from/match BioCyc quite closely.

reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
```
"abbrev" "id"
"n" "CCO-BAC-NUCLEOID"
"j" "CCO-CELL-PROJECTION"
"w" "CCO-CW-BAC-NEG"
"c" "CCO-CYTOSOL"
"e" "CCO-EXTRACELLULAR"
"m" "CCO-MEMBRANE"
"o" "CCO-OUTER-MEM"
"p" "CCO-PERI-BAC"
"l" "CCO-PILUS"
"i" "CCO-PM-BAC-NEG"
```
- CCO: "Celular COmpartment"
- BAC-NUCLEOID: nucleoid
- CELL-PROJECTION: cell projection
- CW-BAC-NEG: TODO confirm: cell wall (of a Gram-negative bacteria)
- CYTOSOL: cytosol
- EXTRACELLULAR: outside the cell
- MEMBRANE: cell membrane
- OUTER-MEM: bacterial outer membrane
- PERI-BAC: periplasm
- PILUS: pilus
- PM-BAC-NEG: TODO: plasma membrane, but that is the same as cell membrane no?
reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
```
"position" "direction" "id" "name"
148 "+" "PM00249" "thrLp"
```
corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
```
"aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
[91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
```
so we understand that:
- aaCount: amino acid count, how many of each of the 20 proteinogenic amino acid are there
- seq: full sequence, using the single letter abbreviation of the proteinogenic amino acids
- mw; molecular weight? The 11 components appear to be given at reconstruction/ecoli/flat/scripts/unifyBulkFiles.py:
  molecular_weight_keys = [ '23srRNA', '16srRNA', '5srRNA', 'tRNA', 'mRNA', 'miscRNA', 'protein', 'metabolite', 'water', 'DNA', 'RNA' # nonspecific RNA ]
  so they simply classify the weight? Presumably this exists for complexes that have multiple classes?
  - 23srRNA, 16srRNA, 5srRNA are the three structural RNAs present in the ribosome: 23S ribosomal RNA, 16S ribosomal RNA, 5S ribosomal RNA, all others are obvious:
  - tRNA
  - mRNA
  - protein. This is the seventh class, and this enzyme only contains mass in this class as expected.
  - metabolite
  - water
  - DNA
  - RNA: TODO rna vs miscRNA
- location: cell compartment where the protein is present, c defined at reconstruction/ecoli/flat/compartments.tsv as cytoplasm, as expected for something that will make an amino acid
reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
```
"halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
```
- halfLife: half-life
- mw: molecular weight, same as in reconstruction/ecoli/flat/proteins.tsv. This molecule only have weight in the mRNA class, as expected, as it just codes for a protein
- location: same as in reconstruction/ecoli/flat/proteins.tsv
- ntCount: nucleotide count for each of the ATGC
- microarray expression: presumably refers to DNA microarray for gene expression profiling, but what measure exactly?

reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:

>E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG

reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
```
"expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
```
- promoter_id: matches promoter id in reconstruction/ecoli/flat/promoters.tsv
- gene_id: matches id in reconstruction/ecoli/flat/genes.tsv
- id: matches exactly those used in BioCyc, which is quite nice, might be more or less standardized:
  - biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486
  - biocyc.org/ECOLI/NEW-IMAGE?type=OPERON&object=TU00178

reconstruction/ecoli/flat/genes.tsv

"length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"

reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
```
"id"                       "mw7.2" "location"
"HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
"L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
```
In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
- biocyc.org/compound?orgid=ECOLI&id=L-ASPARTATE-SEMIALDEHYDE: "L-aspartate 4-semialdehyde" has ID L-ASPARTATE-SEMIALDEHYDE
- biocyc.org/compound?orgid=ECOLI&id=HOMO-SER: "Homoserine" has ID HOMO-SER
so these are the compounds that we care about.

reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:

"reaction id" "stoichiometry" "is reversible" "catalyzed by"

"HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
  {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
  false
  ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]

"HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
  {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
  false
  ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]

catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.

reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
```
"process" "stoichiometry" "id" "dir"
"complexation"
  [
    {
      "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
      "coeff": 1,
      "type": "proteincomplex",
      "location": "c",
      "form": "mature"
    },
    {
      "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
      "coeff": -4,
      "type": "proteinmonomer",
      "location": "c",
      "form": "mature"
    }
  ]
"ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
1
```
The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
Fantastic literature summary! Can't find that in database form there however.

reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:

"name" "comments" "mw" "location" "reactionId" "id"
"aspartate kinase / homoserine dehydrogenase"
""
[0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
["c"]
"ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
"ASPKINIHOMOSERDEHYDROGI-CPLX"

reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.

reconstruction/ecoli/flat/tfIds.csv: transcription factors information:

"TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
"arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
"fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
"dksA" "EG10230"

 Read the full article

E. Coli Whole Cell Model by Covert Lab Updated 2025-07-16

 View more

github.com/CovertLab/WholeCellEcoliRelease is a whole cell simulation model created by Covert Lab and other collaborators.

The project is written in Python, hurray!

But according to te README, it seems to be the use a code drop model with on-request access to master. Ciro Santilli asked at rationale on GitHub discussion, and they confirmed as expected that it is to:

to prevent their publication ideas from being stolen. Who would steal publication ideas with public proof in an issue tracker without crediting original authors? Academia is broken. Academia should be the most open form of knowledge sharing. But instead we get this silly competition for publication points.
to prevent noise from non-collaborators. But they only get like 2 issues as year on such a meganiche subject... Did you know that you can ignore people, and even block them if they are particularly annoying? Much more likely is that no one will every hear about your project and that it will die with its last graduate student slave.

The project is a followup to the earlier M. genitalium whole cell model by Covert lab which modelled Mycoplasma genitalium. E. Coli has 8x more genes (500 vs 4k), but it the undisputed bacterial model organism and as such has been studied much more thoroughly. It also reproduces faster than Mycoplasma (20 minutes vs a few hours), which is a huge advantages for validation/exploratory experiments.

The project has a partial dependency on the proprietary optimization software CPLEX which is freeware, for students, not sure what it is used for exactly, from the comment in the requirements.txt the dependency is only partial.

This project makes Ciro Santilli think of the E. Coli as an optimization problem. Given such external nutrient/temperature condition, which DNA sequence makes the cell grow the fastest? Balancing metabolites feels like designing a Factorio speedrun.

There is one major thing missing thing in the current model: promoters/transcription factor interactions are not modelled due to lack/low quality of experimental data: github.com/CovertLab/WholeCellEcoliRelease/issues/21. They just have a magic direct "transcription factor to gene" relationship, encoded at reconstruction/ecoli/flat/foldChanges.tsv in terms of type "if this is present, such protein is expressed 10x more". Transcription units are not implemented at all it appears.

Everything in this section refers to version 7e4cc9e57de76752df0f4e32eca95fb653ea64e4, the code drop from November 2020, and was tested on Ubuntu 21.04 with a docker install of docker.pkg.github.com/covertlab/wholecellecolirelease/wcm-full with image id 502c3e604265, unless otherwise noted.

 Read the full article

Lie algebra of