Contained in bytes 0x40 to 0x7F.
The first section is always magic: www.sco.com/developers/gabi/2003-12-17/ch4.sheader.html says:
If the number of sections is greater than or equal to SHN_LORESERVE (0xff00), e_shnum has the value SHN_UNDEF (0) and the actual number of section header table entries is contained in the sh_size field of the section header at index 0 (otherwise, the sh_size member of the initial entry contains 0).
There are also other magic sections detailed in
Figure 4-7: Special Section Indexes.Section type:
sh_type == SHT_STRTAB.Common name: "section header string table".
The section name
.shstrtab is reserved. The standard says:This section holds section names.
This section gets pointed to by the
e_shstrnd field of the ELF header itself.String indexes of this section are are pointed to by the
sh_name field of section headers, which denote strings.This section does not have outputs:
SHF_ALLOC marked, so it will not appear on the executing program.readelf -x .shstrtab hello_world.oHex dump of section '.shstrtab':
0x00000000 002e6461 7461002e 74657874 002e7368 ..data..text..sh
0x00000010 73747274 6162002e 73796d74 6162002e strtab..symtab..
0x00000020 73747274 6162002e 72656c61 2e746578 strtab..rela.tex
0x00000030 7400 t.The data in this section has a fixed format: www.sco.com/developers/gabi/2003-12-17/ch4.strtab.html
If we look at the names of other sections, we see that they all contain numbers, e.g. the
.text section is number 7.Then each string ends when the first NUL character is found, e.g. character
12 is \0 just after .text\0.ELF is specified by the LSB:
The LSB basically links to other standards with minor extensions, in particular:
- Generic (both by SCO):
- System V ABI 4.1 (1997) www.sco.com/developers/devspecs/gabi41.pdf, no 64 bit, although a magic number is reserved for it. Same for core files. This is the first document you should look at when searching for information.
- System V ABI Update DRAFT 17 (2003) www.sco.com/developers/gabi/2003-12-17/contents.html, adds 64 bit. Only updates chapters 4 and 5 of the previous document: the others remain valid and are still referenced.
- Architecture specific (by the processor vendor):
A handy summary can be found at:
man elfClear experiment diagram which explains that the droplet mass determined with Stoke's law:Video 1.
Quantum Mechanics 4a - Atoms I by ViaScience (2013)
Source. American Scientific, LLC sells a ready made educational kit for this: www.youtube.com/watch?v=EV3BtoMGA9c
Here's some actual footage of a droplet on a well described more one-off setup:
This American video likely from the 60's shows it with amazing contrast: www.youtube.com/watch?v=_UDT2FcyeA4
Ionizing and non-ionizing radiation by 
Ciro Santilli 34 Updated 2024-12-15 +Created 1970-01-01
Ciro Santilli 34 Updated 2024-12-15 +Created 1970-01-01420 to 680 nm for sure, but larger ranges are observable in laboratory conditions.
It would be boring if we could only simulate the same condition all the time, so let's have a look at the different boundary conditions that we can apply to the cell!
We are able to alter things like the composition of the external medium, and the genome of the bacteria, which will make the bacteria behave differently.
The variant selection is a bit cumbersome as we have to use indexes instead of names, but one you know what you are doing, it is fine.
Of course, genetic modification is limited only to experimentally known protein interactions due to the intractability of computational protein folding and computational chemistry in general, solving those would bsai.
NCBI taxonomy entry: www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=511145 This links to:
- genome: www.ncbi.nlm.nih.gov/genome/?term=txid511145 From there there are links to either:
- Download the FASTA: "Download sequences in FASTA format for genome, protein"For the genome, you get a compressed FASTA file with extension
.fnacalledGCF_000005845.2_ASM584v2_genomic.fnathat starts with:>NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG
- Interactively browse the sequence on the browser viewer: "Reference genome: Escherichia coli str. K-12 substr. MG1655" which eventually leads to: www.ncbi.nlm.nih.gov/nuccore/556503834?report=graphIf we zoom into the start, we hover over the very first gene/protein: the famous (just kidding) e. Coli K-12 MG1655 gene thrL, at position 190-255.The second one is the much more interesting e. Coli K-12 MG1655 gene thrA.
- Gene list, with a total of 4,629 as of 2021: www.ncbi.nlm.nih.gov/gene/?term=txid511145
Graduate course of the University of Oxford by Ciro Santilli 34 Updated 2024-12-15 +Created 1970-01-01
Ciro Santilli 34 Updated 2024-12-15 +Created 1970-01-01 Classification of 4-transitive groups by Ciro Santilli 34 Updated 2024-12-15 +Created 1970-01-01
Ciro Santilli 34 Updated 2024-12-15 +Created 1970-01-01en.wikipedia.org/w/index.php?title=Mathieu_group&oldid=1034060469#Multiply_transitive_groups is a nice characterization of 4 of the Mathieu groups.
The lab that made Chicago Pile-1, located in the University of Chicago. Metallurgical in this context basically as in "working with the metals uranium and plutonium".
Given their experience, they also designed the important X-10 Graphite Reactor and the B Reactor which were built in other locations.
Transfer Android 11 camera videos to Ubuntu 20.10 by Ciro Santilli 34 Updated 2024-12-15 +Created 1970-01-01
Ciro Santilli 34 Updated 2024-12-15 +Created 1970-01-01ARM-based servers.
There are unlisted articles, also show them or only show them.