Now that we've done one section manually, let's graduate and use the readelf -S of the other sections:
  [Nr] Name              Type             Address           Offset
       Size              EntSize          Flags  Link  Info  Align
  [ 2] .text             PROGBITS         0000000000000000  00000210
       0000000000000027  0000000000000000  AX       0     0     16
.text is executable but not writable: if we try to write to it Linux segfaults. Let's see if we really have some code there:
objdump -d hello_world.o
gives:
hello_world.o:     file format elf64-x86-64


Disassembly of section .text:

0000000000000000 <_start>:
   0:       b8 01 00 00 00          mov    $0x1,%eax
   5:       bf 01 00 00 00          mov    $0x1,%edi
   a:       48 be 00 00 00 00 00    movabs $0x0,%rsi
  11:       00 00 00
  14:       ba 0d 00 00 00          mov    $0xd,%edx
  19:       0f 05                   syscall
  1b:       b8 3c 00 00 00          mov    $0x3c,%eax
  20:       bf 00 00 00 00          mov    $0x0,%edi
  25:       0f 05                   syscall
If we grep b8 01 00 00 on the hd, we see that this only occurs at 00000210, which is what the section says. And the Size is 27, which matches as well. So we must be talking about the right section.
This looks like the right code: a write followed by an exit.
The most interesting part is line a which does:
movabs $0x0,%rsi
to pass the address of the string to the system call. Currently, the 0x0 is just a placeholder. After linking happens, it will be modified to contain:
4000ba: 48 be d8 00 60 00 00    movabs $0x6000d8,%rsi
This modification is possible because of the data of the .rela.text section.
This program did not have certain dynamic linking related sections because we linked it minimally with ld.
However, if you compile a C hello world with GCC 8.2:
gcc -o main.out main.c
some other interesting sections would appear.
Given the view of the Standard Model where the electron and quarks are just completely separate matter fields, there is at first sight no clear theoretical requirement for that.
As mentioned e.g. at QED and the men who made it: Dyson, Feynman, Schwinger, and Tomonaga by Silvan Schweber (1994) chapter 1.6 "Hole theory", Dirac initially wanted to think of the holes in his hole theory as the protons, as a way to not have to postulate a new particle, the positron, and as a way to "explain" the proton in similar terms. Others however soon proposed arguments why the positron would need to have the same mass, and this idea had to be discarded.
Very low frequency by Ciro Santilli 40 Updated 2025-07-16
Notably used for communication with submarines, so in particular crucial as part of sending an attack signal to that branch of the nuclear triad.
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
    "n" "CCO-BAC-NUCLEOID"
    "j" "CCO-CELL-PROJECTION"
    "w" "CCO-CW-BAC-NEG"
    "c" "CCO-CYTOSOL"
    "e" "CCO-EXTRACELLULAR"
    "m" "CCO-MEMBRANE"
    "o" "CCO-OUTER-MEM"
    "p" "CCO-PERI-BAC"
    "l" "CCO-PILUS"
    "i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
    148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
    [91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
    174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
    AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
    0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
    657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
    66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
    2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
    "HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    "L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
      {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
      {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
    "complexation"
      [
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
          "coeff": 1,
          "type": "proteincomplex",
          "location": "c",
          "form": "mature"
        },
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
          "coeff": -4,
          "type": "proteinmonomer",
          "location": "c",
          "form": "mature"
        }
      ]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
    "aspartate kinase / homoserine dehydrogenase"
    ""
    [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
    ["c"]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    "ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
    "arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
    "fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
    "dksA" "EG10230"
These are of course likely all made by AtomSea & EMBII themselves while developing/testing their upload system.
They are also artsy peoeple themselves, and as pointed at twitter.com/AllenVandever/status/1563964396656812034 what they were doing was basicaly non-fungible token art, which became much much more popular a few years later around 2021.
The first upload that we could find at github.com/cirosantilli/bitcoin-inscription-indexer/tree/3f53e152ec9bb0d070dbcb8f9249d92f89effa70#atomsea-index was tx 44e80475dc363de2c7ee17b286f8cd49eb146165a79968a62c1c2c4cf80772c9 on block 272573 (2013-12-01) but it does not show on Bitfossil: bitfossil.org/root/44e80475dc363de2c7ee17b286f8cd49eb146165a79968a62c1c2c4cf80772c9/. This is was due to an upload bug explained by the following entry. By looking at the ASCII data at github.com/cirosantilli/bitcoin-inscription-indexer/blob/master/data/out/0272.txt#L449 that this is meant to contain the same content as the following message: a quote from the Bhagavad Gita, so this is definitely a bugged version of the following one.
The next one is tx c9d1363ea517cd463950f83168ce8242ef917d99cd6518995bd1af927d335828 block 272577 (2013-12-02). It actually shows on bifossil and it reads:
I WONDER WHAT HISTORY WILL THINK ABOUT THESE FIRST FEW BUGS...HA HA HA. NOBODY IS PERFECT.
followed by:
He who regards
With an eye that is equal
Friends and comrades,
The foe and the kinsman,
The vile, the wicked,
The men who judge him,
And those who belong
To neither faction:
He is the greatest.
The bug message is definitely a reference to the previous non-visible bugged upload bitfossil.org/root/4b72a223007eab8a951d43edc171befeabc7b5dca4213770c88e09ba5b936e17/, TODO understand exactly how they fucked up. This illustrates the beauty of the blockchain very well: unlike with version control, you don't just see selected snapshots: you see actual debug logs!!!
Figure 1.
WeAreStarStuff.jpg
. Source.
The third AtomSea & EMBII upload, and the first actual image.
Message:
Photo etchin' test. #AtomSea #embii (photo by Travis Ehrich)
The image shows showingAtomSea and EMBII together, presumably photographed by this dude.
The filename is of course a reference to the quote/idea: We Are Made of Star-Stuff that was much popularized by Carl Sagan.
bitfossil.org/root/fac0b9a4f90414710b806fd286e020aea2404498946845ef3783f305dd4cd3a7 (2024-01-13) contains a cropped version with only AtomSea persent.
Figure 2.
HugPuddle.jpg
. Source.
The fourth AtomSea & EMBII upload, and the second image. Message:
HugPuddle Testing Apertus Disk Drive
And then finally we meet Chiharu, EMBII's partner, with her hair painted blond (she's Japanese): ILoveYouMore.jpg.
Then there's an approximation of pi as ASCII decimal fraction on tx 70fd289901bae0409f27237506c330588d917716944c6359a8711b0ad6b4ce76 from block 273522 (2013-12-07):
3.1415926535897932384626433832795028841971693993751058209749445923078164062862089986280348253421170679821480865132823066470938446095505822317253594081284811174502841027019385211055596446229489549303819644288109756659334461284756482337867831652712019091456485669234603486104543266482133936072602491412737245870066063155881748815209209628292540917153643678925903600113305305488204665213841469519415116094330572703657595919530921861173819326117931051185480744623799627495673518857527248912279381830119491298336733624406566430860213949463952247371907021798609437027705392171762931767523846748184676694051320005681271452635608277857713427577896091736371787214684409012249534301465495853710507922796892589235420199561121290219608640344181598136297747713099605187072113499999983729780499510597317328160963185950244594553469083026425223082533446850352619311881710100031378387528865875332083814206171776691473035982534904287554687311595628638823537875937519577818577805321712268066130019278766111959092164201989
tx b8b9f50a354166c46b69ecd47a0fbd20ee78c3471d2557bf275aff1b4cf4752d (2013-12-07) on bitfossil.org) contains Where the Sidewalk Ends by Shel Silverstein:
There is a place where the sidewalk ends
And before the street begins,
And there the grass grows soft and white,
And there the sun burns crimson bright,
And there the moon-bird rests from his flight
To cool in the peppermint wind.
Let us leave this place where the smoke blows black
And the dark street winds and bends.
Past the pits where the asphalt flowers grow
We shall walk with a walk that is measured and slow,
And watch where the chalk-white arrowls go
To the place where the sidewalk ends.
Yes we'll walk with a walk that is measured and slow,
And we'll go where the chalk-white arrows go,
For the children, they mark, and the children, they know
The place where the sidewalk ends.
bitfossil.org/root/73ca50321147bac9010bec43d63f7f76857fe9ede240cc89710e28723fdb242f/ (2013-12-14) has message:
MULTIFILE SUPPORT TEST
and links to 3 .txt files 1.txt, 2.txt, 3.txt containing single characters 1, 2, and 3.
Figure 3.
CompressedLogo.png
. Source.
2013-12-20. Message:
Colby Nelson and myself burnt the midnight oils designing the APERTUS imagery last night....
Thanks Colby for all your help.
Possibly www.linkedin.com/in/colby-nelson-59b538207/.
Contains an Apertus logo which is used on bitfossil.org/root/ itself, presumably they were designing that logo.
Permanent private hall by Ciro Santilli 40 Updated 2025-07-16
Similar to a college, but led by religious denomination leaders rather than fellows.

There are unlisted articles, also show them or only show them.