E. Coli K-12 MG1655 gene arcA Updated 2025-07-16
Transcription factor for E. Coli K-12 MG1655 operon thrLABC as shown at biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486.
Note that this is very close to the "end" of the genome.
E. Coli K-12 MG1655 gene fnr Updated 2025-07-16
E. Coli K-12 MG1655 gene thrA Updated 2025-07-16
NCBI entry: www.ncbi.nlm.nih.gov/gene/945803.
This protein is an enzyme. The UniProt entry clearly shows the chemical reactions that it catalyses. In this case, there are actually two! It can either transforming the metabolite:Also interestingly, we see that both of those reaction require some extra energy to catalyse, one needing adenosine triphosphate and the other nADP+.
TODO: any mention of how much faster it makes the reaction, numerically?
Since this is an enzyme, it would also be interesting to have a quick search for it in the KEGG entry starting from the organism: www.genome.jp/pathway/eco01100+M00022 We type in the search bar "thrA", it gives a long list, but the last entry is our "thrA". Selecting it highlights two pathways in the large graph, so we understand that it catalyzes two different reactions, as suggested by the protein name itself (fused blah blah). We can now hover over:Note that common cofactor are omitted, since we've learnt from the UniProt entry that this reaction uses ATP.
- the edge: it shows all the enzymes that catalyze the given reaction. Both edges actually have multiple enzymes, e.g. the L-Homoserine path is also catalyzed by another enzyme called metL.
- the node: they are the metabolites, e.g. one of the paths contains "L-homoserine" on one node and "L-aspartate 4-semialdehyde"
If we can now click on the L-Homoserine edge, it takes us to: www.genome.jp/entry/eco:b0002+eco:b3940. Under "Pathway" we see an interesting looking pathway "Glycine, serine and threonine metabolism": www.genome.jp/pathway/eco00260+b0002 which contains a small manually selected and extremely clearly named subset of the larger graph!
But looking at the bottom of this subgraph (the UI is not great, can't Ctrl+F and enzyme names not shown, but the selected enzyme is slightly highlighted in red because it is in the URL www.genome.jp/pathway/eco00260+b0002 vs www.genome.jp/pathway/eco00260) we clearly see that thrA, thrB and thrC for a sequence that directly transforms "L-aspartate 4-semialdehyde" into "Homoserine" to "O-Phospho-L-homoserine" and finally tothreonine. This makes it crystal clear that they are not just located adjacently in the genome by chance: they are actually functionally related, and likely controlled by the same transcription factor: when you want one of them, you basically always want the three, because you must be are lacking threonine. TODO find transcription factor!
The UniProt entry also shows an interactive browser of the tertiary structure of the protein. We note that there are currently two sources available: X-ray crystallography and AlphaFold. To be honest, the AlphaFold one looks quite off!!!
By inspecting the FASTA for the entire genome, or by using the NCBI open reading frame tool, we see that this gene lies entirely in its own open reading frame, so it is quite boring
From the FASTA we see that the very first three Codons at position 337 arewhere
ATG CGA GTG
ATG
is the start codon, and CGA GTG should be the first two that actually go into the protein:ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER mentions that the enzime is most active as protein complex with four copies of the same protein:TODO image?
Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
E. Coli K-12 MG1655 gene thrB Updated 2025-07-16
Immediately follows e. Coli K-12 MG1655 gene thrA,
Part of E. Coli K-12 MG1655 operon thrLABC.
E. Coli K-12 MG1655 gene thrC Updated 2025-07-16
E. Coli K-12 MG1655 gene thrL Updated 2025-07-16
The first gene in the E. Coli K-12 MG1655 genome. Remember however that bacterial chromosome is circular, so being the first doesn't mean much, how the choice was made: Section "E. Coli genome starting point".
Part of E. Coli K-12 MG1655 operon thrLABC.
At only 65 bp, this gene is quite small and boring. For a more interesting gene, have a look at the next gene, e. Coli K-12 MG1655 gene thrA.
Does something to do with threonine.
This is the first in the sequence thrL, thrA, thrB, thrC. This type of naming convention is quite common on related adjacent proteins, all of which must be getting transcribed into a single RNA by the same promoter. As mentioned in the analysis of the KEGG entry for e. Coli K-12 MG1655 gene thrA, those A, B and C are actually directly functionally linked in a direct metabolic pathway.
We can see that thrL, A, B, and C are in the same transcription unit by browsing the list of promoter at: biocyc.org/group?id=:ALL-PROMOTERS&orgid=ECOLI. By finding the first one by position we reach; biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486.
E. Coli K-12 MG1655 promoter thrLp Updated 2025-07-16
E. Coli Whole Cell Model by Covert Lab Source code overview Updated 2025-07-16
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
reconstruction/ecoli/flat/compartments.tsv
contains cellular compartment information:"abbrev" "id" "n" "CCO-BAC-NUCLEOID" "j" "CCO-CELL-PROJECTION" "w" "CCO-CW-BAC-NEG" "c" "CCO-CYTOSOL" "e" "CCO-EXTRACELLULAR" "m" "CCO-MEMBRANE" "o" "CCO-OUTER-MEM" "p" "CCO-PERI-BAC" "l" "CCO-PILUS" "i" "CCO-PM-BAC-NEG"
CCO
: "Celular COmpartment"BAC-NUCLEOID
: nucleoidCELL-PROJECTION
: cell projectionCW-BAC-NEG
: TODO confirm: cell wall (of a Gram-negative bacteria)CYTOSOL
: cytosolEXTRACELLULAR
: outside the cellMEMBRANE
: cell membraneOUTER-MEM
: bacterial outer membranePERI-BAC
: periplasmPILUS
: pilusPM-BAC-NEG
: TODO: plasma membrane, but that is the same as cell membrane no?
reconstruction/ecoli/flat/promoters.tsv
contains promoter information. Simple file, sample lines:corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148."position" "direction" "id" "name" 148 "+" "PM00249" "thrLp"
reconstruction/ecoli/flat/proteins.tsv
contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:so we understand that:"aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId" [91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
aaCount
: amino acid count, how many of each of the 20 proteinogenic amino acid are thereseq
: full sequence, using the single letter abbreviation of the proteinogenic amino acidsmw
; molecular weight? The 11 components appear to be given atreconstruction/ecoli/flat/scripts/unifyBulkFiles.py
:so they simply classify the weight? Presumably this exists for complexes that have multiple classes?molecular_weight_keys = [ '23srRNA', '16srRNA', '5srRNA', 'tRNA', 'mRNA', 'miscRNA', 'protein', 'metabolite', 'water', 'DNA', 'RNA' # nonspecific RNA ]
23srRNA
,16srRNA
,5srRNA
are the three structural RNAs present in the ribosome: 23S ribosomal RNA, 16S ribosomal RNA, 5S ribosomal RNA, all others are obvious:- tRNA
- mRNA
- protein. This is the seventh class, and this enzyme only contains mass in this class as expected.
- metabolite
- water
- DNA
- RNA: TODO
rna
vsmiscRNA
location
: cell compartment where the protein is present,c
defined atreconstruction/ecoli/flat/compartments.tsv
as cytoplasm, as expected for something that will make an amino acid
reconstruction/ecoli/flat/rnas.tsv
: TODO vstranscriptionUnits.tsv
. Sample lines:"halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression" 174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
halfLife
: half-lifemw
: molecular weight, same as inreconstruction/ecoli/flat/proteins.tsv
. This molecule only have weight in themRNA
class, as expected, as it just codes for a proteinlocation
: same as inreconstruction/ecoli/flat/proteins.tsv
ntCount
: nucleotide count for each of the ATGCmicroarray expression
: presumably refers to DNA microarray for gene expression profiling, but what measure exactly?
reconstruction/ecoli/flat/sequence.fasta
: FASTA DNA sequence, first two lines:>E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp) AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
reconstruction/ecoli/flat/transcriptionUnits.tsv
: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:"expression_rate" "direction" "right" "terminator_id" "name" "promoter_id" "degradation_rate" "id" "gene_id" "left" 0.0 "f" 310 ["TERM0-1059"] "thrL" "PM00249" 0.198905992329492 "TU0-42486" ["EG11277"] 148 657.057317358791 "f" 5022 ["TERM_WC-2174"] "thrLABC" "PM00249" 0.231049060186648 "TU00178" ["EG10998", "EG10999", "EG11000", "EG11277"] 148
promoter_id
: matches promoter id inreconstruction/ecoli/flat/promoters.tsv
gene_id
: matches id inreconstruction/ecoli/flat/genes.tsv
id
: matches exactly those used in BioCyc, which is quite nice, might be more or less standardized:
reconstruction/ecoli/flat/genes.tsv
"length" "name" "seq" "rnaId" "coordinate" "direction" "symbol" "type" "id" "monomerId" 66 "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189 "+" "thrL" "mRNA" "EG11277" "EG11277-MONOMER" 2463 "ThrA" "ATGCGAGTGTTG" "EG10998_RNA" 336 "+" "thrA" "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
reconstruction/ecoli/flat/metabolites.tsv
contains metabolite information. Sample lines:In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine"."id" "mw7.2" "location" "HOMO-SER" 119.12 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"] "L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction IDHOMOSERDEHYDROG-RXN
, and that page which clarifies the IDs:so these are the compounds that we care about.- biocyc.org/compound?orgid=ECOLI&id=L-ASPARTATE-SEMIALDEHYDE: "L-aspartate 4-semialdehyde" has ID
L-ASPARTATE-SEMIALDEHYDE
- biocyc.org/compound?orgid=ECOLI&id=HOMO-SER: "Homoserine" has ID
HOMO-SER
- biocyc.org/compound?orgid=ECOLI&id=L-ASPARTATE-SEMIALDEHYDE: "L-aspartate 4-semialdehyde" has ID
reconstruction/ecoli/flat/reactions.tsv
contains chemical reaction information. Sample lines:"reaction id" "stoichiometry" "is reversible" "catalyzed by" "HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51." {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1} false ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"] "HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53." {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1 false ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
catalized by
: here we seeASPKINIHOMOSERDEHYDROGI-CPLX
, which we can guess is a protein complex made out ofASPKINIHOMOSERDEHYDROGI-MONOMER
, which is the ID for thethrA
we care about! This is confirmed incomplexationReactions.tsv
.
reconstruction/ecoli/flat/complexationReactions.tsv
contains information about chemical reactions that produce protein complexes:The"process" "stoichiometry" "id" "dir" "complexation" [ { "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX", "coeff": 1, "type": "proteincomplex", "location": "c", "form": "mature" }, { "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER", "coeff": -4, "type": "proteinmonomer", "location": "c", "form": "mature" } ] "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN" 1
coeff
is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:Fantastic literature summary! Can't find that in database form there however.Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
reconstruction/ecoli/flat/proteinComplexes.tsv
contains protein complex information:"name" "comments" "mw" "location" "reactionId" "id" "aspartate kinase / homoserine dehydrogenase" "" [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0] ["c"] "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN" "ASPKINIHOMOSERDEHYDROGI-CPLX"
reconstruction/ecoli/flat/protein_half_lives.tsv
contains the half-life of proteins. Very few proteins are listed however for some reason.reconstruction/ecoli/flat/tfIds.csv
: transcription factors information:"TF" "geneId" "oneComponentId" "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes" "arcA" "EG10061" "PHOSPHO-ARCA" "PHOSPHO-ARCA" "fnr" "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX" "dksA" "EG10230"
Operon Updated 2025-07-16
A single operon may produce multiple different transcription units depending on certain conditions, see: operon vs transcription unit.
Operon vs transcription unit Updated 2025-07-16
Consider the E. Coli K-12 MG1655 operon thrLABC.
That single operon can produce two different mRNA transcription units:
- thrL only, the transcription unit is also called thrL: biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486
- thrL + thrA + thrB + thrC all together, the transcription unit is called thrLABC: biocyc.org/ECOLI/NEW-IMAGE?type=OPERON&object=TU00178
The reason for this appears to be that there is a rho-independent termination region after thrL. But then under certain conditions, that must get innactivated, and then the thrLABC is produced instead.
Polycistronic mRNA Updated 2025-07-16
Multiple genes coding for multiple proteins in one transcription unit, e.g. e. Coli K-12 MG1655 gene thrL and e. Coli K-12 MG1655 gene thrA are both prat of the E. Coli K-12 MG1655 operon thrLABC.
Transcription unit Updated 2025-07-16
For an example, see E. Coli K-12 MG1655 operon thrLABC.
Multiple different transcription units can be produced by a single operon, see: operon vs transcription unit.