E. Coli K-12 MG1655 gene arcA Updated +Created
Note that this is very close to the "end" of the genome.
TODO DNA assembly structure.
E. Coli K-12 MG1655 gene thrA Updated +Created
The second gene in the E. Coli K-12 MG1655 genome. Part of the E. Coli K-12 MG1655 operon thrLABC.
Part of a reaction that produces threonine.
This protein is an enzyme. The UniProt entry clearly shows the chemical reactions that it catalyses. In this case, there are actually two! It can either transforming the metabolite:
  • "L-homoserine" into "L-aspartate 4-semialdehyde"
  • "L-aspartate" into "4-phospho-L-aspartate"
Also interestingly, we see that both of those reaction require some extra energy to catalyse, one needing adenosine triphosphate and the other nADP+.
TODO: any mention of how much faster it makes the reaction, numerically?
Since this is an enzyme, it would also be interesting to have a quick search for it in the KEGG entry starting from the organism: www.genome.jp/pathway/eco01100+M00022 We type in the search bar "thrA", it gives a long list, but the last entry is our "thrA". Selecting it highlights two pathways in the large graph, so we understand that it catalyzes two different reactions, as suggested by the protein name itself (fused blah blah). We can now hover over:
  • the edge: it shows all the enzymes that catalyze the given reaction. Both edges actually have multiple enzymes, e.g. the L-Homoserine path is also catalyzed by another enzyme called metL.
  • the node: they are the metabolites, e.g. one of the paths contains "L-homoserine" on one node and "L-aspartate 4-semialdehyde"
Note that common cofactor are omitted, since we've learnt from the UniProt entry that this reaction uses ATP.
If we can now click on the L-Homoserine edge, it takes us to: www.genome.jp/entry/eco:b0002+eco:b3940. Under "Pathway" we see an interesting looking pathway "Glycine, serine and threonine metabolism": www.genome.jp/pathway/eco00260+b0002 which contains a small manually selected and extremely clearly named subset of the larger graph!
But looking at the bottom of this subgraph (the UI is not great, can't Ctrl+F and enzyme names not shown, but the selected enzyme is slightly highlighted in red because it is in the URL www.genome.jp/pathway/eco00260+b0002 vs www.genome.jp/pathway/eco00260) we clearly see that thrA, thrB and thrC for a sequence that directly transforms "L-aspartate 4-semialdehyde" into "Homoserine" to "O-Phospho-L-homoserine" and finally tothreonine. This makes it crystal clear that they are not just located adjacently in the genome by chance: they are actually functionally related, and likely controlled by the same transcription factor: when you want one of them, you basically always want the three, because you must be are lacking threonine. TODO find transcription factor!
The UniProt entry also shows an interactive browser of the tertiary structure of the protein. We note that there are currently two sources available: X-ray crystallography and AlphaFold. To be honest, the AlphaFold one looks quite off!!!
By inspecting the FASTA for the entire genome, or by using the NCBI open reading frame tool, we see that this gene lies entirely in its own open reading frame, so it is quite boring
From the FASTA we see that the very first three Codons at position 337 are
ATG CGA GTG
where ATG is the start codon, and CGA GTG should be the first two that actually go into the protein:
ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER mentions that the enzime is most active as protein complex with four copies of the same protein:
Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
TODO image?
E. Coli K-12 MG1655 gene thrL Updated +Created
The first gene in the E. Coli K-12 MG1655 genome. Remember however that bacterial chromosome is circular, so being the first doesn't mean much, how the choice was made: Section "E. Coli genome starting point".
At only 65 bp, this gene is quite small and boring. For a more interesting gene, have a look at the next gene, e. Coli K-12 MG1655 gene thrA.
Does something to do with threonine.
This is the first in the sequence thrL, thrA, thrB, thrC. This type of naming convention is quite common on related adjacent proteins, all of which must be getting transcribed into a single RNA by the same promoter. As mentioned in the analysis of the KEGG entry for e. Coli K-12 MG1655 gene thrA, those A, B and C are actually directly functionally linked in a direct metabolic pathway.
We can see that thrL, A, B, and C are in the same transcription unit by browsing the list of promoter at: biocyc.org/group?id=:ALL-PROMOTERS&orgid=ECOLI. By finding the first one by position we reach; biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486.
Source code overview Updated +Created
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
    "n" "CCO-BAC-NUCLEOID"
    "j" "CCO-CELL-PROJECTION"
    "w" "CCO-CW-BAC-NEG"
    "c" "CCO-CYTOSOL"
    "e" "CCO-EXTRACELLULAR"
    "m" "CCO-MEMBRANE"
    "o" "CCO-OUTER-MEM"
    "p" "CCO-PERI-BAC"
    "l" "CCO-PILUS"
    "i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
    148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
    [91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
    • aaCount: amino acid count, how many of each of the 20 proteinogenic amino acid are there
    • seq: full sequence, using the single letter abbreviation of the proteinogenic amino acids
    • mw; molecular weight? The 11 components appear to be given at reconstruction/ecoli/flat/scripts/unifyBulkFiles.py:
      molecular_weight_keys = [
        '23srRNA',
        '16srRNA',
        '5srRNA',
        'tRNA',
        'mRNA',
        'miscRNA',
        'protein',
        'metabolite',
        'water',
        'DNA',
        'RNA' # nonspecific RNA
        ]
      so they simply classify the weight? Presumably this exists for complexes that have multiple classes?
    • location: cell compartment where the protein is present, c defined at reconstruction/ecoli/flat/compartments.tsv as cytoplasm, as expected for something that will make an amino acid
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
    174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
    • halfLife: half-life
    • mw: molecular weight, same as in reconstruction/ecoli/flat/proteins.tsv. This molecule only have weight in the mRNA class, as expected, as it just codes for a protein
    • location: same as in reconstruction/ecoli/flat/proteins.tsv
    • ntCount: nucleotide count for each of the ATGC
    • microarray expression: presumably refers to DNA microarray for gene expression profiling, but what measure exactly?
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
    AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
    0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
    657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
    66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
    2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
    "HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    "L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
      {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
      {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
    "complexation"
      [
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
          "coeff": 1,
          "type": "proteincomplex",
          "location": "c",
          "form": "mature"
        },
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
          "coeff": -4,
          "type": "proteinmonomer",
          "location": "c",
          "form": "mature"
        }
      ]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
    "aspartate kinase / homoserine dehydrogenase"
    ""
    [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
    ["c"]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    "ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
    "arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
    "fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
    "dksA" "EG10230"
Operon Updated +Created
Sequence of genes under a single promoter. For an example, see E. Coli K-12 MG1655 operon thrLABC.
A single operon may produce multiple different transcription units depending on certain conditions, see: operon vs transcription unit.
Operon vs transcription unit Updated +Created
That single operon can produce two different mRNA transcription units:
The reason for this appears to be that there is a rho-independent termination region after thrL. But then under certain conditions, that must get innactivated, and then the thrLABC is produced instead.
Polycistronic mRNA Updated +Created
Transcription unit Updated +Created
A sequence of mRNA that can actually be transcribed.
Multiple different transcription units can be produced by a single operon, see: operon vs transcription unit.