The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
    "n" "CCO-BAC-NUCLEOID"
    "j" "CCO-CELL-PROJECTION"
    "w" "CCO-CW-BAC-NEG"
    "c" "CCO-CYTOSOL"
    "e" "CCO-EXTRACELLULAR"
    "m" "CCO-MEMBRANE"
    "o" "CCO-OUTER-MEM"
    "p" "CCO-PERI-BAC"
    "l" "CCO-PILUS"
    "i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
    148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
    [91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
    174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
    AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
    0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
    657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
    66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
    2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
    "HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    "L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
      {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
      {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
    "complexation"
      [
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
          "coeff": 1,
          "type": "proteincomplex",
          "location": "c",
          "form": "mature"
        },
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
          "coeff": -4,
          "type": "proteinmonomer",
          "location": "c",
          "form": "mature"
        }
      ]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
    "aspartate kinase / homoserine dehydrogenase"
    ""
    [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
    ["c"]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    "ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
    "arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
    "fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
    "dksA" "EG10230"
Unfortunately, due to lack of one page to rule them all, the on-Git tree publication list is meager, some of the most relevant ones seems to be:
JavaScript by Ciro Santilli 40 Updated 2025-07-16
The language all browsers converted to as of 2019, and therefore the easiest one to distribute and most widely implemented programming language.
Hopefully will be killed by WebAssembly one day.
Because JavaScript is a relatively crap/ad-hoc language, it ended up some decent tooling to make up for that, e.g. stuff like linting via ESLint and reformatting through Prettier is much more widespread than in other languages.
JavaScript data structure are also quite a bit anemic, which makes libraries such as lodash incredibly popular. But most of that stuff should be in the stdlib.
Our JavaScript examples can be found at:
Tried a quick port to SQLite to get rid of annoying local databases for development, but failed, at c1c2cc4e448b279ff083272df1ac50d20c3304fa
npm install sqlite3 --save-dev
and
{
  "type": "sqlite",
  "database": "db.sqlite3",
  "entities": ["src/**/**.entity{.ts,.js}"],
  "synchronize": true
}
then:
npm start
fails with:
DataTypeNotSupportedError: Data type "timestamp" in "ArticleEntity.created" is not supported by "sqlite" database.
Attempt to hack it:
--- a/src/article/article.entity.ts
+++ b/src/article/article.entity.ts
@@ -20,10 +20,10 @@ export class ArticleEntity {
   @Column({default: ''})
   body: string;

-  @Column({ type: 'timestamp', default: () => "CURRENT_TIMESTAMP"})
+  @Column({ default: () => "CURRENT_TIMESTAMP"})
   created: Date;

-  @Column({ type: 'timestamp', default: () => "CURRENT_TIMESTAMP"})
+  @Column({ default: () => "CURRENT_TIMESTAMP"})
   updated: Date;
and after that it seems to run.
I can signup and login, terrible error reporting as usual, make sure to use long enough usernames/passwords.
However, article creation fails with:
Unhandled Rejection (TypeError): Cannot read property 'slug' of undefined
TODO why did Python kill it? They are very similar and existed at similar times, and possibly Perl was more popular early on.
Perl likely killed Tcl.
pip (package manager) by Ciro Santilli 40 Updated 2025-09-09
How many stupid bugs. How many stupid bugs do we need to face???
JCVI-syn3A by Ciro Santilli 40 Updated 2025-07-16
essential metabolism for a minimal cell (2019) mentions:
JCVI-syn3A, a robust minimal cell with a 543 kbp genome and 493 genes, provides a versatile platform to study the basics of life.
Based on JCVI-syn3.0, they've added a few genes back to give better phenotypes, including slightly faster duplication time. Because the development cycle time is your God is also true in biology.
As of essential metabolism for a minimal cell (2019) it had only 91 genes of unknown function! So funny.
Bibliograpy:
Figure 1. Source. A description is present at: cdn.rcsb.org/pdb101/goodsell/2022_JCVI-syn3A.pdf Integrative Illustration of a JCVI-syn3A Minimal Cell by David Goodsell (2022) which describes everything in the picture.
Dihedral group by Ciro Santilli 40 Updated 2025-07-16
Our notation: , called "dihedral group of degree n", means the dihedral group of the regular polygon with sides, and therefore has order (all rotations + flips), called the "dihedral group of order 2n".
Ruby on Rails by Ciro Santilli 40 Updated 2025-07-16
The only reason why Ruby exists.
This web framework is pretty good as of 2020 compared to others, because it managed to gain a critical community size, and there's a lot of basic setup already done for you.
it is just big shame it wasn't written in Python or even better, Node.js, because learning Ruby is completely useless for anything else. As of 2020 for example, most Node.js web frameworks feel like crap compared to Rails, you just have to debug so much there.
Used in GitLab, which is why Ciro Santilli touched it.
Placozoan by Ciro Santilli 40 Updated 2025-07-16
Now that's some basal shit! It's basically a fucking blob!!! Except that it is flat. No nervous system. Not even tissues. It is basically a multicellular
Whenever you make a change to your material, people should still be able to access the previous version.
Maybe there was something in the previous version that they needed, and you just removed.
Git + GitHub is the perfect way to do versioning.
Brooks's law by Ciro Santilli 40 Updated 2025-07-16
Video 1.
The Misty Mountains Cold Scene from The Hobbit: An Unexpected Journey (2012)
Source.
I will take each and every one of these dwarves over an army from the Iron Hills. For when I called upon them they answered. Loayalty. Honour. And willing heart. I can ask no more than that.

Pinned article: Introduction to the OurBigBook Project

Welcome to the OurBigBook Project! Our goal is to create the perfect publishing platform for STEM subjects, and get university-level students to write the best free STEM tutorials ever.
Everyone is welcome to create an account and play with the site: ourbigbook.com/go/register. We belive that students themselves can write amazing tutorials, but teachers are welcome too. You can write about anything you want, it doesn't have to be STEM or even educational. Silly test content is very welcome and you won't be penalized in any way. Just keep it legal!
We have two killer features:
  1. topics: topics group articles by different users with the same title, e.g. here is the topic for the "Fundamental Theorem of Calculus" ourbigbook.com/go/topic/fundamental-theorem-of-calculus
    Articles of different users are sorted by upvote within each article page. This feature is a bit like:
    • a Wikipedia where each user can have their own version of each article
    • a Q&A website like Stack Overflow, where multiple people can give their views on a given topic, and the best ones are sorted by upvote. Except you don't need to wait for someone to ask first, and any topic goes, no matter how narrow or broad
    This feature makes it possible for readers to find better explanations of any topic created by other writers. And it allows writers to create an explanation in a place that readers might actually find it.
    Figure 1.
    Screenshot of the "Derivative" topic page
    . View it live at: ourbigbook.com/go/topic/derivative
  2. local editing: you can store all your personal knowledge base content locally in a plaintext markup format that can be edited locally and published either:
    This way you can be sure that even if OurBigBook.com were to go down one day (which we have no plans to do as it is quite cheap to host!), your content will still be perfectly readable as a static site.
    Figure 2.
    You can publish local OurBigBook lightweight markup files to either https://OurBigBook.com or as a static website
    .
    Figure 3.
    Visual Studio Code extension installation
    .
    Figure 4.
    Visual Studio Code extension tree navigation
    .
    Figure 5.
    Web editor
    . You can also edit articles on the Web editor without installing anything locally.
    Video 3.
    Edit locally and publish demo
    . Source. This shows editing OurBigBook Markup and publishing it using the Visual Studio Code extension.
    Video 4.
    OurBigBook Visual Studio Code extension editing and navigation demo
    . Source.
  3. https://raw.githubusercontent.com/ourbigbook/ourbigbook-media/master/feature/x/hilbert-space-arrow.png
  4. Infinitely deep tables of contents:
    Figure 6.
    Dynamic article tree with infinitely deep table of contents
    .
    Descendant pages can also show up as toplevel e.g.: ourbigbook.com/cirosantilli/chordate-subclade
All our software is open source and hosted at: github.com/ourbigbook/ourbigbook
Further documentation can be found at: docs.ourbigbook.com
Feel free to reach our to us for any help or suggestions: docs.ourbigbook.com/#contact