Ciro Santilli @cirosantilli 37

 Articles (11k) Discussions (26) Comments (64) Follows  Received likes Files

New Updated  Top  Announced  A-Z  Liked  Followed

Drug liberalization Updated 2025-07-16

Ciro Santilli supports full legalization of all drugs, because he feels that it would be better overall for the world to have cheaper drugs and more drug addicts, but way, way less organized crime.

These should be extremely controlled of course, with extremely high taxes that puts their price just below the current illegal market, and a complete ban on any positive advertising.

Ciro believes that maybe the government could even go as far as giving free drugs to drug addicts so they don't have to rob to get a fix.

This is notably considering that drug-led organized crime completely dominates and corrupts the politics of many production and trafficking zones, which are already generally poor fucked up places to start with:

Ciro's experiences in Brazil such as mentioned at São Remo, the favela next to USP, although much less extreme than the above, also come to mind.

Drug traffic corrupts everything. It prevents development of honest people. It is a cancer, which we have failed time and time a gain to cure. The only cure is to accept the other less insidious of addiction.

Bibliography:

How to Fix a Drug Scandal (2020) gives a good sense of the relentlessness of the drug war, and how it affects people who are already poor the most

 Read the full article

Program optimization Updated 2025-07-16

 Read the full article

Dual vector Updated 2025-07-16

Dual vectors are the members of a dual space.

In the context of tensors , we use raised indices to refer to members of the dual basis vs the underlying basis:

e_{1} e_{2} e_{3} e^{1} e^{2} e^{3} \in V \in V \in V \in V^{*} \in V^{*} \in V^{*}

The dual basis vectors

e^{i}

are defined to "pick the corresponding coordinate" out of elements of V. E.g.:

e^{1} (4, - 3, 6) e^{2} (4, - 3, 6) e^{3} (4, - 3, 6) = 4 = - 3 = 6

By expanding into the basis, we can put this more succinctly with the Kronecker delta as:

e^{i} (e_{j}) = δ_{ij}

Note that in Einstein notation, the components of a dual vector have lower indices. This works well with the upper case indices of the dual vectors, allowing us to write a dual vector

f

as:

f = f_{i} e^{i}

In the context of quantum mechanics, the bra notation is also used for dual vectors.

 Read the full article

Early Google employee Updated 2025-07-16

Bibliography:

ChatGPT produces:

Heather Cairns (Employee #4) - Joined in 1998. She handled HR and was one of the earliest administrative hires.
Harry Cheung (Employee #5) - Joined in 1999. An early engineer.
Gerald Aigner (Employee #6) - Hired in 1999. Worked as a software engineer.
Susan Wojcicki (Employee #16) - Joined in 1999. She rented her garage to Larry and Sergey in 1998 and later became an integral part of Google's business and advertising teams.
Marissa Mayer (Employee #20) - Hired in 1999. Played a major role in Google Search and design.

Omid Kordestani - Joined in 1999 as Google’s first business hire, focusing on sales and revenue generation.

 Read the full article

Endocytosis Updated 2025-07-16

 Read the full article

E. Coli genome starting point Updated 2025-07-16

The conventional starting point is not at the E. Coli K-12 MG1655 origin of replication.

biocyc.org/ECOLI/NEW-IMAGE?type=EXTRAGENIC-SITE&object=G0-10506 explains:

This site is the origin of replication of the E. coli chromosome. It contains the binding sites for DnaA, which is critical for initiation of replication. Replication proceeds bidirectionally. For historical reasons, the numbering of E. coli's circular chromosome does not start at the origin of replication, but at the origin of transfer during conjugation.

If it is a bit hard to understand what they mean by "origin of transfer" though, as that term is usually associated with the origin of transfer of bacterial conjugation.

 Read the full article

E. Coli K-12 MG1655 Updated 2025-07-16

NCBI taxonomy entry: www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=511145 This links to:

genome: www.ncbi.nlm.nih.gov/genome/?term=txid511145 From there there are links to either:
- Download the FASTA: "Download sequences in FASTA format for genome, protein"
  For the genome, you get a compressed FASTA file with extension .fna called GCF_000005845.2_ASM584v2_genomic.fna that starts with:
  >NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG
  Using wc as in wc GCF_000005845.2_ASM584v2_genomic.fna gives 58022 lines, in Vim we see that each line is 80 characters, except for the final one which is 52. So we have 58020 * 80 + 52 = 4641652 =~ 4.6 Mbp
- Interactively browse the sequence on the browser viewer: "Reference genome: Escherichia coli str. K-12 substr. MG1655" which eventually leads to: www.ncbi.nlm.nih.gov/nuccore/556503834?report=graph
  If we zoom into the start, we hover over the very first gene/protein: the famous (just kidding) e. Coli K-12 MG1655 gene thrL, at position 190-255.
  The second one is the much more interesting e. Coli K-12 MG1655 gene thrA.
- Gene list, with a total of 4,629 as of 2021: www.ncbi.nlm.nih.gov/gene/?term=txid511145

KEGG entry: www.genome.jp/pathway/eco01100+M00022

BioCyc promoter database query URL: biocyc.org/group?id=:ALL-PROMOTERS&orgid=ECOLI

 Read the full article

E. Coli K-12 MG1655 gene of unknown function Updated 2025-07-16

All gene names that start with an Y such as:

appear to be proteins of unknown function.

UniProt for example describes YaaX as "Uncharacterized protein YaaX".

As function is discovered, they then change it to a better name, e.g. to names such as the E. Coli K-12 MG1655 transcription unit thrLABC proteins all of which have a clear name due to threonine.

There are many other y??? as of 2021! Though they do tend to be smaller molecules.

 Read the full article

E. Coli replication time Updated 2025-07-16

20 minutes in optimal conditions, with a crazy multiple start sites mechanism: E. Coli starts DNA replication before the previous one finished.

Otherwise, naively, would take 60-90 minutes just to replicate and segregate the full DNA otherwise. So it starts copying multiple times.

biology.stackexchange.com/questions/30080/how-can-e-coli-proliferate-so-rapidly
stochasticscientist.blogspot.co.uk/2012/02/how-e-coli-grows-so-fast.html
www.ncbi.nlm.nih.gov/pmc/articles/PMC2063475/ Organization of sister origins and replisomes during multifork DNA replication in Escherichia coli by Fossum et al (2007)

 Read the full article

Maxima and minima Updated 2025-07-16

Given a function

f

:

from some space. For beginners the real numbers but more generally topological spaces should work in general
to the real numbers

we want to find the points

x

of the domain of

f

where the value of

f

is smaller (for minima, or larger for maxima) than all other points in some neighbourhood of

x

.

In the case of Functionals, this problem is treated under the theory of the calculus of variations.

 Read the full article

E. Coli Whole Cell Model by Covert Lab / Other run variants Updated 2025-07-16

Besides time series run variants, conditions can also be selected directly without a time series as in:

python runscripts/manual/runSim.py --variant condition 1 1

which select row indices from reconstruction/ecoli/flat/condition/condition_defs.tsv. The above 1 1 would mean the second line of that file which starts with:

"condition" "nutrients" "genotype perturbations" "doubling time (units.min)" "active TFs"
"basal" "minimal" {} 44.0 []
"no_oxygen" "minimal_minus_oxygen" {} 100.0 []
"with_aa" "minimal_plus_amino_acids" {} 25.0 ["CPLX-125", "MONOMER0-162", "CPLX0-7671", "CPLX0-228", "MONOMER0-155"]

so 1 means no_oxygen.

 Read the full article

Quantum computers are not expected to solve NP-complete problems Updated 2025-07-16

Only NP-intermediate, which includes notably integer factorization:

 Read the full article

100,000 Genomes Project Updated 2025-07-16

 Read the full article

Quantum key distribution protocol Updated 2025-07-16

 Read the full article

Quantum logic gate Updated 2025-07-16

At Section "Quantum computing is just matrix multiplication" we saw that making a quantum circuit actually comes down to designing one big unitary matrix.

We have to say though that that was a bit of a lie.

Quantum programmers normally don't just produce those big matrices manually from scratch.

Instead, they use quantum logic gates.

The following are the main reasons for that:

 Read the full article

100 Greatest Discoveries by the Discovery Channel (2004-2005) Updated 2025-07-16

www.imdb.com/title/tt0442715/ on IMDb

Hosted by Bill Nye.

Physics topics:

Galileo: objects of different masses fall at the same speed, hammer and feather experiment
Newton: gravity, linking locally observed falls and the movement of celestial bodies
TODO a few more
superconductivity, talk only at Fermilab accelerator, no re-enactment even...
quark, interview with Murray Gell-Mann, mentions it was "an off-beat field, one wasn't encouraged to work on that". High level blablabla obviously.
fundamental interactions, notably weak interaction and strong interaction, interview with Michio Kaku. When asked "How do we know that the weak force is there?" the answer is: "We observe radioactive decay with a Geiger counter". Oh, come on!

biology topics:

Leeuwenhoek microscope and the discovery of microorganisms, and how pond water is not dead, but teeming with life. No sample of course.
1831 Robert Brown cell nucleus in plants, and later Theodor Schwann in tadpoles. This prepared the path for the idea that "all cells come from other cells", and the there seemed to be an unifying theme to all life: the precursor to DNA discoveries. Re-enactment, yay.
1971 Carl Woese and the discovery of archaea

Mendel. Reenactment.
1909 Thomas Hunt Morgan with Drosophila melanogaster. Reenactment. Genes are in Chromosomes. He observed that a trait was linked to sex, and it was already known that sex was related to chromosomes.
1935 George Beadle and the one gene one enzyme hypothesis by shooting X-rays at bread mold
1942 Barbara McClintock, at Cold Spring Harbor Laboratory
1952 Hershey–Chase experiment. Determined that DNA is what transmits genetic information, not protein, by radioactive labelling both protein and DNA in two sets of bacteriophages. They observed that only the DNA radioactive material was passed forward.
Crick Watson
messenger RNA, no specific scientist, too many people worked on it, done partially with bacteriophage experiments
1968 Nirenberg genetic code
1972 Hamilton O. Smith and the discovery of restriction enzymes by observing that they were part of anti bacteriophage immune-system present in bacteria
alternative splicing
RNA interference
Human Genome Project, interview with Craig Venter.

blood circulation
anesthesia
X-ray
germ theory of disease, with examples from Ignaz Semmelweis and Pasteur
1796 Edward Jenner discovery of vaccination by noticing that cowpox cowpox infected subjects were immune
vitamin by observing scurvy and beriberi in sailors, confirmed by Frederick Gowland Hopkins on mice experiments
Fleming, Florey and Chain and the discovery of penicillin
Prontosil
diabetes and insulin

 Read the full article

108 Stars of Destiny Updated 2025-07-16

The concept is a strong part of Water Margin.

The very first chapter opens with Grand Commander Hou disrespecting spirits by opening up a sealed tomb and unintentionally releasing 108 demons who presumably reincarnate as humans, a backstory to the events that follow years later.

This is well shown in the Japanese The Water Margin, but is skipped in the Chinese The Water Margin unfortunately.

The concept is also central to the Suikoden video game.

Actually, now that Ciro Santilli thinks about it, these were already likely meant as a "collectible" element by the author of the original book, as is strongly suggested by all the little illustrations of each character present on the Wikipedia page. Just like e.g. Catholic saints. It's Pokemon, but 2000 years earlier.

Ciro would notably feel many years later, that as he met random people online who were interested in improving eduction, or was otherwise networking to reach his goals, as if he were actually building up his 108 stars of destiny.

A central part, and perhaps the most interesting part of the novel, is how each character has been motivated by injustice to join the rebellion. This reminds Ciro of Final Fantasy VI

 Read the full article

1987 Nobel Prize in Physics Updated 2025-07-16

This was so hot (no pun intended) and reproducible that the prize was awarded one year after discovery. Quite rare in those days already.

 Read the full article

2007 Nobel Prize in Physics Updated 2025-07-16

 Read the full article

2008 Nobel Prize in Chemistry Updated 2025-07-16

For the discovery of green fluorescent protein.

 Read the full article

 Unlisted articles are being shown, click here to show only listed articles.