Ciro Santilli Updated +Created
Ciro Santilli is a male human software engineer and activist born in Brazil, Earth in 1989 AD.
Quick facts:
Other people with the same name are listed at Section "Ciro Santilli's homonyms".
Figure 1.
19th century illustration of the Journey to the West protagonist Sun Wukong
. Source.
Sun Wukong (孙悟空) is a playful and obscenely powerful monkey Journey to the West. He protects Buddhist monk Tang Sanzang, and likes eating fruit, just like Ciro. Oh, and Goku from Dragon Ball is based on him. His japanese name is "Sun Wukong" (same Chinese characters with different Japanese pronunciation) for the love. His given name "Wukong" means literally "the one who mastered the void", which is clearly a Dharma name and fucking awesome in multiple ways. This is another sad instance of a Chinese thing better known in the West as Japanese.
It is worth noting however that although Wukong is extremely charming, Ciro's favorite novel of the Four Great Classic Novels is Water Margin. Journey to the West is just a Monster of the Week for kids, but Water Margin is a fight for justice saga. Sorry Wukong!
Figure 2.
Ciro Santilli playing with a pipette at the University of Cambridge circa 2017
.
The photo was taken in an open event organized by the awesome Cambridge Synthetic Biology outreach group, more or less the same people who organize: www.meetup.com/Cambridge-Synthetic-Biology-Meetup/ and who helped organize Section "How to use an Oxford Nanopore MinION to extract DNA from river water and determine which bacteria live in it".
Taking part in such activities is what Ciro tries to do to overcome his lifelong regret of not having done more experimental stuff at university. Would he have had the patience to handle all the bullshit of the physical word without going back to the informational sciences? Maybe, maybe not. But now he will probably never know?!
Notice the orange high visibility cycling jersey under the lab coat, from someone who had just ridden in from work as fast as possible as part of his "lunch break". It is more fun when it is hard.
Figure 3.
Scribe Jean Miélot, 15th century
.
Ciro Santilli fantasises that he would have make a good scribe in the middle ages, partly due to his self diagnosed graphomania, but also appreciation for foreign languages, and his mild obsession with the natural sciences.
OurBigBook.com is Ciro's view of a modern day scriptorium, except that now the illuminations are YouTube videos.
Chill and eat your bread in peace comes to mind. A scribe, in a library, reading and writing the entire day in peace and quiet. The life!
The job of a Internet-age scribe is basically that of making knowledge more open, legally extracting it from closed copyrighted sources, and explaining your understanding of it to the wider world under Creative Commons licenses on the web. And in the process of greater openess, given a well organized system, we are able combine the knowledge of many diffferent people, and thus make things more understandable than any single/few creator closed source source could ever achieve.
Ciro once saw some cartoon on Wikipedia help pages of a turtle with a book in one hand, and typing into Wikipedia on its computer, TODO find it. That cartoon summarizes well the modern scribe life.
Another analogous version of this fantasy more in touch with Ciro's sinophily is the ideal of the Chinese scholar, notably including their stereotypical attributes such as mastery of the Four arts.
Figure 4.
Ciro Santilli piling boxes as a child
. A natural born engineer.
Ciro Santilli's minor projects Updated +Created
These are some smaller projects that Ciro Santilli carried out. They are all either for fun, or misguided use of his time done by an younger self:
ASCII art Updated +Created
There are a few dozen ASCII arts in the blockchain.
Almost all of them are copy pastes of stuff present elsewhere, or boring high resolution ones auto-generated from images. But hey, it's still fun to see.
  • block 229417 (2013-04-03) has a cute one liner sword miner message by HHTT:
    ./SockThing/HHTT/o()xxxx[{::::::::::::::::::::::::::::::::::>
  • 5acc5293506c65d346d6ca171d8e8b73b39b3f99fb16a98cc7f3ce9dbe27a87c (2014-03-10) goes straight to the point:
    +----+
    |fuck|
    +----+
  • tx 9f17f3ce43019c24baa6d679edfdddeada856f617cd9c1f6008d49be4542b768, block 301412 (2014-05-18) TODO wft, what/who is "poutine". Cthulhu is of course the fictional (?) entity created by writer H. P. Lovecraft.
      _--------.
     /    ~~~~~~\                     p o u t i n e
    (_   ~~~@~~@|     Cthulhu wants your bitcoin/dogecoin, plz donate
     \   ~~//|\\\  |
      \   \|||/\\\_/
      /   /|//_/|/__   BTC : 1JsJs5d6E5SmJSGUiQ12uF1GDZxTCUWvf
     /    \_\ \|\|     DOGE: D93mn1utTc7REQQPjQSjFf9Boupm32gw88
    There were a few small donations: www.blockchain.com/explorer/addresses/BTC/1JsJs5d6E5SmJSGUiQ12uF1GDZxTCUWvf
  • tx 7b537ad012439c6306dd74e13ba9c20926d68d04fc0c6da2fc81a8eb8f9ea017, block 322917 (2014-09-28) via cryptograffiti.info: hello, it's the Internet:
             /\_/\
        ____/ o o \
      /~____  =
    = /
     (______)__m_m)
  • Figure 1. . tx 09a5d5aaecdce1757e6ec713cc8a2201abca9acdb6fbadc7760e831cdad3d680 (2014-10-01) high resolution image of two men wearing a suit with the bitcoin logo on the background, followed by "if you like it, leave a tip: 1MDBHLGV7WX9viRG9X4LfDQfCX8oZ9w". Both men look quite similar, so quite likely it's the Winklevoss twins, who had a big and later catastrophic involvement with Bitcoin. The tip address appears to be cropped and is incorrect, ooops. 777db7bfbea2c525d5adb05a8fbf47736e2311492f4614e5d38ab199b4bbfac2 give the likely correct version of it "1MDBHLgv7WX9viRG9X4LfDQfCX8oZ9wviC".
  • tx e577e60f4008a00175ef3f3266f052949440009b2ac65e4957da114db29bf96d (2014-11-03) @jamesmorgan. Possibly this Twitter account: twitter.com/jamesmorgan but it was suspended as of January 2024. It had only a single archive from 2008 at: web.archive.org/web/20081007152024/http://twitter.com/JamesMorgan but nothing special about it besides the 2008 vibe of Twitter CSS:
       _____     __
      / ___ \   |__|____    _____   ____   ______ ____   _____   ___________  _________    ____
     / / ._\ \  |  \__  \  /     \_/ __ \ /  ___// ___\ /     \ /  _ \_  __ \/ ___\__  \  /    \
    <  \_____/  |  |/ __ \|  Y Y  \  ___/ \___ \/ /_/  >  Y Y  (  <_> )  | \/ /_/  > __ \|   |  \
     \_____\/\__|  (____  /__|_|  /\___  >____  >___  /|__|_|  /\____/|__|  \___  (____  /___|  /
            \______|    \/      \/     \/     \/_____/       \/            /_____/     \/     \/
  • Figure 2. . (2014-10-12). Associated text:
    if you like it, leave a tip: 1MDBHLgv7WX9viRG9X4LfDQfCX8oZ9wviC
    Portrait of a young man. TODO identify. 1MDBHLgv7WX9viRG9X4LfDQfCX8oZ9wviC was tipped twice so far: www.blockchain.com/explorer/addresses/btc/1MDBHLgv7WX9viRG9X4LfDQfCX8oZ9wviC for 0.00240 BTC and 0.02490000 BTC in 2014.
  • tx c6df8850871fce6c8764af2a0a4155241fc987db57abd8c9ead0165895e1ccc4 (2014-11-04): TODO what company is this the logo of? It seems very familiar, Ciro Santilli has certainly seen it before but can't remember where...:
                     `-:+syhhhhhhyo/-.
                  ./sdmmmmmmmmmmmmmmddy/.`
                :sdmmmmmdddddhhysyhhddddho-`
              -ydmmmmddddddddddhhyso++yhddh/``
             +dmmmdddddddyso++/++shdy+:/+ydho``
            +dmmdddddhhy:``       ./sh/.-/yhho`
           -dmmdddhhhy/`            `/y/`./yho-
          .hmddddhhhs:                :h.`::/-:`
          ydmmmdhhhy`                  s+ .` `.-
          ymmmmdhhh+                   /o  @R*.
          /mmmmdhhhs`                  ..
          `hmmmdhhhh/
           ommmdddhhh-
           .hmmmddhhhh+-`
            .hmmmmddhhhhso+:----:+o+/:-
             :smmmmdddhhhhhhhhhhhhdddhh/
             ` -sdmmmmddddddddddddddmmmd-
                 .odmmmmmmmmmmmmmmmmmmd:`
                   .-:odhmmmmmNNNNmdo/.
                       ``-sooosyho``
    
    -JGM
  • The Hashling
    
      /\|--|/\
      /\|OO|/\
      /\|--|/\
    
    @BraveTheWorld
    @petertoddbtc
    Code 1.
    The Hashling
    .
    "The Hashling" presumably refers to a cute fictional crab-like animal that somehow inhabits the alternate reality created Blockchain network's incredible hashrate. Yet another souless NFT collection would later be created with that name as well: magiceden.io/ordinals/marketplace/hashlings.B
    But that is not all! Immediately after the ASCII art encoded as one constant, the remaining constants of the input script except for the last one encode a raw PNG image with a hand drawing of the creature:
    https://raw.githubusercontent.com/cirosantilli/media/master/bitcoin-inscription-indexer/data/bin/a96bda1363e8968f45b05e3c1940ba37b18de53de0157d453ca9bfc44913768c.png
    The last constant is then the only thing that matters and spends the incoming output.
    The ASCII art and image are also inscribed 16 more times on the blockchain: github.com/cirosantilli/bitcoin-inscription-indexer/blob/master/data/hashling. 453c9511ca76361c8c44b4302ce1b5d8d5c98a938b548478ef931baaa7d70e62 also has the image without any ASCII strings.
    Peter Todd is the author of Peter Todd's hash collision puzzles. @BraveTheWorld is presumably twitter.com/BraveTheWorld, but it is less clear what are they.
  • tx 57a4edce05dee9012ff5991532e9aa02aef82ee8d3ebecb9f833c12bfbc708fe (2014-12-19) via cryptograffiti.info "MERRY CHRISTMAS! & HAPPY NEW YEAR!!" with a really ugly father Christmas with gift bag. Reproduced at: asciiart.website/index.php?art=holiday/christmas/santa where is is credited From: Heather Classen <classen@aware.com>, Date: 22 Dec 1994 17:00:58 -0600
      MERRY CHRISTMAS!              __ _ __ ___
            &                  _ __'.:;.:;.:;.:`
      HAPPY NEW YEAR!        _'.:;.:;.:;.:;.:;.:`
                            '.:. , :`,.,`;'/`__ _` _
                            '..:;.;'.:,.;.:;\      (_)
                          -__ --_-_-_-__---_-)
                        (                    )
      ____               (_- -__-_-__-____-__-)
    /####\ /\            |  ,~~~'  `~~~.   %@
    |#####\#|             )  ><@>  <@><    %@%
    |#######|            /      /          %@p
      \######|            ( *   (_c)   * )  % %      .vvvvvvvv.
      |#####|             \ '%@%@%@%@`, %@%@       .vvvvvvvvvv.
      /#####\         _ _ d%@ `----' @%@%@ \ _ _ _.vvvvvvvvvvvvv.
      ~~~~~~~       ':;.;%@@%@%@%@%@%@@%p  /.:;.:;vvvvvvvvvvvvvvv.
        `.:;.'     ':;.;%@@%@%@@%@%@%@%@ :: ____vvmvvvvvvvvvvvvvvvv.
        :.:;.:`   ':;.:d%@%@%@%@%@%@@%@%.:;/####\/\.:;\mvvvvvvvvvvvv
        :.:;.:;` ';.;;.%@%@@%@%@@%@%@%@p.:;|#####\#|.:;\mvvvvvvvvvvvv.
        :.:;.:;./;.;;.;%@%@%@%@%@%@%@%@ ::.'\######|.:;\mnvvvvvvvvvvvv
        :.:;.:;.|:.;.;.% %@%@%@%@%@% % :  mvv\#####|.:;.\mnvvvvvvvvvvv
        :.:;.:;/:;.;.:;.q%@%@@%@%@ %p.:;vv%mv|#####\.:;.\mnvvvvvvvvvv
        :.:;.:;|:;.:;.;;;%@%@@% %.:;.:;.vmnv. ~~~~~~ .:;.|mvvvvvvvvvv.
        :.:;.:/.:;.:;.:;.: o  .:;.:;.:;.vv.:;/.:;.:;\.:;.|mnvvvvvvvvv.
        `.:;.|:;.:;;;.:;.    .:;;;;;;;;;;;;;|.:;.:;.\.:;\mnvvvvvvvv.
          `::/:;;;.:;;.:; o  .:;.;;.:;;;.:;.:|.:;.:;.:\.:;\mnvvvvvnm
            ;.:;;.:;;.:     :;;;.:;.:;.:;.:;\.:;.:;.:;.:;|mnvvvnm.
            :::;.:;.:;. o  ..:;.:;.:;;;;.;;;;\.:;.:;.:;.:|mnvvnm.
            :::;.:;;.:     .:;;;;;;;;.:;.:;;;|.:;.:;.:;./mmvnm.
            ;.:;.:;.;. o   .:;.;.:;;.:;.:;.:;.\________/mmmnm.
            :.:;;;.;;;     .:;;.:;.:;;.:;.:;.:;.;.:;;;;`mmnn
              `#######HHOHHH###########################
              #######HHOHHH###########################
              '::;;;.;; o  :;;;.:;.:;;.;;;;;;;;;;;.:;.:`  H.Classen
  • tx 69708943906eb32a320a5a450fed450b0f14b4e475a98bc74615962b68a0bc83 (2015-01-24) via cryptograffiti.info "All Glory to he HYPNO TOAD" signed "SSt" has an ASCII art of HypnoToad, a ficticius mind controlling frog creature from Futurama: Fandom, KnowYourMeme. The same ASCII art can be seen for example at: www.gotfuturama.com/Multimedia/AsciiArt/HypnoSebastian.shtml
          ,'``.._   ,'``.
        :,--._:)\,:,._,.:       All Glory to
        :`--,''   :`...';\      the HYPNO TOAD!
          `,'       `---'  `.
          /                 :
        /                   \
      ,'                     :\.___,-.
      `...,---'``````-..._    |:       \
        (                 )   ;:    )   \  _,-.
        `.              (   //          `'    \
          :               `.//  )      )     , ;
        ,-|`.            _,'/       )    ) ,' ,'
      (  :`.`-..____..=:.-':     .     _,' ,'
        `,'\ ``--....-)='    `._,  \  ,') _ '``._
    _.-/ _ `.       (_)      /     )' ; / \ \`-.'
    `--(   `-:`.     `' ___..'  _,-'   |/   `.)
        `-. `.`.``-----``--,  .'
          |/`.\`'        ,','); SSt
              `         (/  (/
    Figure 3.
    Hypno toad
    . Off-chain reference image for the ASCII art
  • tx 0913d8125167f728cec1b95d27e6fc62a7a45af35eecfefd3b5000e367ee1468 (2015-02-01) via cryptograffiti.info: ASCII typeface add for an unsuccesful cryptocurrency with a link to its homepage zeit-coin.net:
             _ _            _
            (_) |          (_)
     _______ _| |_ ___ ___  _ _ __
    |_  / _ \ | __/ __/ _ \| | '_ \
     / /  __/ | || (_| (_) | | | | |
    /___\___|_|\__\___\___/|_|_| |_|
    http://zeit-coin.net
  • tx 43b0bb63fc50ad1edbb17486dc44825e4dd642a952c699cc13958e010ba3d8a5 (2015-02-26) has a star of David. Possibly related news from the day prior: www.theguardian.com/world/2015/jan/25/jewish-leaders-europe-legislation-outlawing-antisemitism "Jewish leaders call for Europe-wide legislation outlawing antisemitism"
               /\
              /  \
             / /\ \
    ________/ /__\_\________
    \  ____/ /___________  /
     \ \  / /      \ \  / /
      \ \/ /        \ \/ /
       \ \/          \ \/
       /\ \          /\ \
      / /\ \        / /\ \
     / /__\_\______/ /__\ \
    /_____________/ /______\
            \ \  / /
             \ \/ /
              \  /
               \/
    
        HELLO FROM ZOG
    The signature however appears ironic and could stand for "Zionist Occupation Government"
  • Muy feliz cumple Manu! ---- The Fantastic Four Gang :-D
    ~?O8O7?I$O8888OOZZ$$$7?=~::::::::::::$$8ODZZZ7I,.....,8D88O88O88$I?=7ZO88DDDNDNN
    7888DD888888888OOZZZ$$I+=~:::::~IONNNNNNMNNNMMNMN8~:.,:+888D88O$$$Z$OZOO8DDNNNNM
    88DDDDD8D88888888OZZZZI?=~::~+ODNMNNNMNMMMMMMMMMMNNND~,:?D8D88Z$$$7Z$ZZO8DNNNNNN
    8DDDDNDDD8888OOO8OOOOZ7?=~~+DDDND8NDD88NNNMNMNNNMMMMMND?ODDD888ZOOOOOO88DNNNNNDD
    DD8DDDDDDD88O8O8OOOOOO7?++DDDDD8DDDDD8DDND888NDDNNMMMNMNZ$8DDDDD8DDDDDDDNNNNNNND
    88D888888D88888O88O8OZ$7O8DD8DDNNNDDDDDND8888NDDDNNMNNNNDDO8888DD8DDDDDDNNNNNNND
    88D888888888888888888OZZO88DNDDDDD8D88OOOOO8DDNDNDNNNNNDDDOI+?$88D88D8DDNNNNNNNN
    88D8888D88888888D8D8DO$O8DDNDZ77I???+?++++++IZO8O8O888OOD8D$,,,~Z8OO888DDDNNNNDD
    DDD8888888DDDDDDDDDD8ZO8DDD8$I??+++===~~~~::~~=+===+?I$Z8888=..,7$OOOZO8DDNNNNDD
    888D88DDD888DDDDDDD8ZO8DDDDO7?+++++=~~~~~:~:::::::::::~~+$8D$..:78OOOZO88DDNNDDD
    88O888D88OOOO8DD8DD$888DDNDZ7?+?+?++==~~~~:::::::::::,::~=88DI,+88888OOO88DD888O
    O88888DDOOOOOO88DD8Z88NDNNOZ7???+++===~~~::::::::::::::::~$O88OO8888DD8O888OZZZO
    88O8D8888OZZO8O88DOODDNDDD8OI????++===~~:~::::::::::::::::?ZOOOOOO8OD8DDDDOOOZ7$
    88O8O888O8OOOO88DDO8D8NNNN8O7III?++===~~~:::::::::::::::::?ZOZOZOOO8DDDDDD8877$Z
    8O8888D8O8DDDDDDDDO8NDDDNNZ7I???+===~=~~~~~::::::::::::::~?OZZZ888D8D8888888$$$$
    8O8D88OO88DDDNNNNDZDNNDDN87I?????I$7???++===:~~~~~~::::,:=IO$$O88DD8D888D8DDZ$$$
    8888OOZZZO88DDDDDDO8NDDNDZII??7Z8O88NNNDOI?++=++++++==~::=$8ZZ88DDN8DD8DDDHACKER
    DD88O$$7$ZOOOO88D87ODDDND7??I7$$7777$OOO8O$?+=+$88DDD8O7:~$8$$88DNDNNNDDNNNNNNND
    DDD8O$77$$ZZOOO8DIOZZ8DNZ???7$ZODDNMMI8$8ZI=~:+IZOZ7II+=?=78$$O8NDNNNNNDNNNNNNDD
    DDD8OZZ$ZZOOOO8ODI$7$O8D????III7ZZ$$7IIII77=::+?7OZNDOZ=?~IO7Z8DDDDDDNNNDNNNNDDD
    DNDD88OO88DD88DDNI$?I$OZ??????????+++?+??II+~:==?77$7???+~=$+7DNDDDDDDDDNDDDND88
    NNDNNDDDDNDDNDNDD$I?O8IIII??++++++++===+??I+:::~=++=++~~~:=77ZNNDDDDDDDDDDDDD888
    DDNDDDDNDDNDDDDDNNII77I?II???+====~=~==+???=::::~:~~=~~:::=$+NNDDDDDNDDDDDDDDD88
    NNNNNDNNNNNDDDDDDD??+7??I??I??+==~~===+I??+~:::~::~:~~::::~?=DDNDDDDDNNDDDDDDD8D
    NNNNNNNNNNDDDNNDDN$?I?IIIIIIII??=+=+?I$I+I?=~~::==~::::::~=~NDDNDDDDNDDDDDDDD888
    NNNNMNNNNNNNNNNNNNNO??I$I?II777I?+??777$8D8$?+NO=+=~::::~~~?NNNNNDNNNNNNNDDDD8O8
    NNNNMMMMMMNNNNNNNNDNN8$ZI?II7$$7I7I77?I7ZZOO$I+==++=~~:~=~:MMNNNNNNNNNNNNNDDD8OO
    NNNMMMMMMMMNMNNNNNNNNDO7??III7$777I7I7IIII$$$?+=~=?====~~:+MMNMMMNMMMMNNNDDD888O
    NMNMMMMMMMMMMMMMNMNNNNDI??IIII$7I?I$$77$7I+=~~~~=?I==+==+?MMMMMMMMMMMMNNDDD8888O
    NMMMMMMMMMMMMMMMMMMMNND??IIIIIIII?+?8O+I~=~I=IZZ?I$?+=+=8MMMMMMMMMMMMMNNDD888888
    NMMMMMMMMMMMMMMNMMMMMNN??I7777I77I=+?III+~:~:,~+?+I+++==MMMMMMMMMMMMMMMDDDDDDDDD
    MNMMMMMMMMMMMMMMMMMMNNN?I777777I7I??++?I?++=~~=~:~+=+++IMMMMMMMMMMMMMMMMNNNNMMMM
    MMMMNNNNNMMMMMMMMMMMNMM?I77777II77I???++?IIII+~~:~===++MMMMMMMMMMMMMMMMMMMMMMMMM
    MMMMMMMMMMMMMMMMMMMMMMN+II7$7$$77III???++++===~~~~=+++MMMMMMMMMMMMMMMMMMMMMMMMMM
    MMMMMMMNMMMMMMMNMMMMMMN??I77$7$$7$7I?+++==~~~~~~~~=+?MMMMMMMMMMMMMMMMMMMMMMMMMMM
    MMMMMMNMMMMMMMMMMMMZ=+??II77$$$$77777I+==~~~~~:~~=+?MMMMMMMMMMMMMMMMMMMMMMMMMMMM
    MMMMNNNMMMMMMMMMM:+?II???II77$ZZZ$$$$$II+===+~~==??MMMMMMMMMMMMMMMMMMMMMMMMMMMMM
    MMMMMNNNNNMMMMMM7:I?77I?IIII7$$ZZOOZ7$$$7I??III?++8NMMMMMMMMMMMMMMMMMMMMMMMMMMMM
    MMMMMNMNNNMMMMMM,:I?$$IIIIIII7$$ZZZZ88OZ$$$777I?+=NNMMMMMMMMMMMMMMMMMMMMMMMMMMMM
    MMMMMMMMNNNMMMMZ,,?7ZO7IIIIIII7$$$$$$ZOOOZ7????++=DMMMMMMMMMMMMMMMMMMMMMMMMMMMMM
    MMMMMMMMMNNMMM8:,,,,Z$7I?I??I7777$$$$$$7II?++++++,ZMMMMMMMMMMMMMMMMMMMMMMMMMMMMM
    MMMMMMMMMMMNDI,,,,,,,?7II?????II7777777I?+???++++.8MMMMMMMMMMMMMMMMMMMMMMMMMMMMM
    MMMMMMNNND=,,,,,,,,,,,.?????????IIII7I7I???++++=~.?MMMMMMMMMMMMMMMMMMMMMMMMMMMMM
    MMMN7:,,....,,,,,,,,,,,..??+++++?????III?++++++$.,..IDMMMMMMMMMMMMMMMMMMMMMMMMMM
    Code 2.
    Muy feliz cumple Manu!
    tx 00d8871c1b3fb85912616bb2602b5a9869a345d9fa092f8454614c6158c83d10 (2015-04-08)
    Muy feliz cumple Manu! ---- The Fantastic Four Gang :-Dwhich means: "Happy birthday, Manu", in Spanish, followed by Manu's face in medium resolution
    The given names of the other three of the "Fantastic Four Gang" are then given at Figure 4. "Viva la Revolucion! Happy Birthday Santi".
    Figure 4.
    Viva la Revolucion! Happy Birthday Santi
    .
    tx 1b35d4b9506ab80ec7fc5542f73271cbb72090aa3f70bfa77670f8bd43d072a7, block 378022, 2015-10-08) has a message:
    Viva la Revolucion! Happy Birthday Santi! Manu, Santi, Demi, Estebanand starts a long chain of contiguous transactions that renders Santi's face twice in low resolution. They are encoded one line every two transactions with OP_RETURN:
    Both blocks were mined by AntPool, so they weren't mining themselves to enforce ordering. So how is ordering assured? TODO are transactions actually contiguous in the block or are there other transactions interspersed? According to:
    bitcoin-core.cli getblock 00000000000000000baf6e3006fd05a1c5dbca3d430012180f8098cbe8b8ce22
    many of the transactions are contiguous but we haven't checked all of them.
  • Figure 5.
    Warren Buffet
    .
    tx 0fc0c50e410b62ee3a316135711116db6b4e728841c976f29ab85e2a41e0dcc3 (2015-08-02) Associated message:
    if you like it, leave a tip: 1P675gRxNwhFXgfuDu5yXwGDgwLDbXNJqz BM-2cUDAqyqcnksx7YDtgu2y72xDxcRjPeYfo
    1P675gRxNwhFXgfuDu5yXwGDgwLDbXNJqz was never tipped so far: www.blockchain.com/explorer/addresses/btc/1P675gRxNwhFXgfuDu5yXwGDgwLDbXNJqz TODO what is "BM-2cUDAqyqcnksx7YDtgu2y72xDxcRjPeYfo"?
    Figure 6. . Source. Off-chain reference image for the ASCII art.
    This image was likely inscribed due to Buffet's general status as an investing God. Interestingly, in a twist of fate, Buffer would later come to strongly criticize cryptocurrency as worthless: finance.yahoo.com/news/warren-buffett-says-wouldnt-pay-175917403.html.
  • Figure 7. . tx 467c075ee6edaa60f184d0683655f1f6d267efd98061872f167ef7ca9ca7c50f (2015-08-09). The eyebrows are a bit wrong, and he is a bit too young for the original series. Minor manual fixes were applied by Ciro Santilli, it is unknown why this was needed.
  • tx beeead7429cdb78f3bfe8a17d8e485a3a847b3e99a511a025bb49e2948af5058, block 378735 (2015-10-13) contains a happy birthday message:
    To my dear friend Mariano, por muchos anos más de diversión!
    the Spanish part translates to:
    Here's to many more years of fun
    It does not show well in our ASCII jumps because the non ASCII characters are UTF-8-encoded. Europeans... This is followed by the ASCII art with Marian's nerdy face in it:
     _______  _______ ____      ___   _______    _______  __   __  __   __  _______  ___      _______
    |       ||       ||   |    |   | |       |  |       ||  | |  ||  |_|  ||       ||   |    |       |
    |    ___||    ___||   |    |   | |____   |  |       ||  | |  ||       ||    _  ||   |    |    ___|
    |   |___ |   |___ |   |    |   |  ____|  |  |       ||  |_|  ||       ||   |_| ||   |    |   |___
    |    ___||    ___||   |___ |   | | ______|  |      _||       ||       ||    ___||   |___ |    ___|
    |   |    |   |___ |       ||   | | |_____   |     |_ |       || ||_|| ||   |    |       ||   |___
    |___|    |_______||_______||___| |_______|  |_______||_______||_|   |_||___|    |_______||_______|          
    
                                              ``````
                                      ``..---------------...``
                                    `.--------------------------.`
                                  .-------------------------------.`
                                 .----------------------------------`
                                `------------------------------------`
                                .------------------------------------.
                                ------------:+yo------+yo:-----------.
                                ---------/shhs+:------:+shhs+--------.
                              ``--------so$/:--------------:/os--------``
                            `.-------------/oso:------:ooo/--------------`
                            .------------:ho:-:ohsssshs:--+h:------------.
                            .------------so-----y+--/h-----+y------------.
                            .-----------:-:h+--:oh----ys:--+h/-----------.
                            .-------------/ooo/------:ooo+--------------.`
                              `..------------------------------------..`
                                .----------------------------------.
                                `-----------.```....```.-----------`
                                 .------------.``````.------------`
                                  `-----------------------------.`
                                    `.-----------------------..`
                                       ``....----------....``
    
               __   __  _______  ______    ___   _______  __    _  __   __   __
              |  |_|  ||   _   ||    _ |  |   | |   _   ||  |  | ||  | |  | |  |
              |       ||  |_|  ||   | ||  |   | |  |_|  ||   |_| ||  | |  | |  |
              |       ||       ||   |_||_ |   | |       ||       ||  | |  | |  |
              |       ||       ||    __  ||   | |       ||  _    ||__| |__| |__|
              | ||_|| ||   _   ||   |  | ||   | |   _   || | |   | __   __   __
              |_|   |_||__| |__||___|  |_||___| |__| |__||_|  |__||__| |__| |__|
    which reads:
    Feliz cumple, Marian
    which means:
    Happy Birthday, Marian
    The message is encoded with OP_RETURN payloads across multiple transactions, 40 bytes per transaction. They actually managed to upload two almost fully consecutive transaction blocks and in the correct order. Could they be miners?
    Some of the payloads contain newlines, you are just supposed to paste all payloads together to form the image. Our reconstruction here is manual however, lazy to script it properly.
  • tx f6039915b829377849be87fc242303873e6574528db7916dd81ff44141b3560f (2016-04-27) via cryptograffiti.info contains some candles followed by poem that starts with:
    vaardig regulerend de orde van de dag
    Is in Dutch of course, literally:
    skillfully regulating the order of the day
    Given the date and language, it appears to be a reference to Koningsdag, Dutch national holiday that celebrated the birthday of their King at the time, King Willem-Alexander. Born in 1956, he would have been turning 60 at the time, so a nice round number in 2016 when these birthday candles were inscribed.
                      )                    `
                    /(l                   /)
                    (  \                  / (
                    ) * )                ( , )
                    \#/                  \#'
                  .-"#'-.             .-"#"=,
                (  |"-.='|            '|"-,-"|
                )\ |     |  ,        /(|     | /(         ,
      (       /  )|     | (\       (  \     | ) )       ((
      )\     (   (|     | ) )      ) , )    |/ (        ) \
      /  )     ) . )     |/  (     ( # (     ( , )      /   )
    ( * (      \#/|     (`# )      `#/|     |`#/      (  '(
      \#/     .-"#'-.   .-"#'-,   .-"#'-.   .-=#"-;     `#/
    .-"#'-.   |"=,-"|   |"-.-"|)  1"-.-"|   |"-.-"|   ,-"#"-.
    |"-.-"|   |  !  |   |     |   |     |   |     !   |"-.-"|
    |     |   |     |._,|     |   |     |._,|     a   |     |
    |     |   |     |   |     |   |     |   |     p   |     |
    |     |   |     |   |     |   |     |   |     x   |     |
    '-._,-'   '-._,-'   '-._,-'   '-._,-'   '-._,-"   '-._,-'
    The poem also appears at: 2422215c9a6040c0e337bf1c1e9b2b32244a1e36f3dd3e79fb77592c90bbb5a8.
  • tx a55e7587bb34a56ae1113b0848506ea2fcf0c0e1af8c241e76677eb2bcb727eb (2016-04-27) via cryptograffiti.info
    /y            _,     _   _    ,_
              o888P     Y8o8Y     Y888o.
            d88888      88888      88888b
          ,8888888b_  _d88888b_  _d8888888,
          888888888888888888888888888888888
          888888888888888888888888888888888
            Y8888P"Y888P"Y888P-Y888P"Y88888'
            Y888   '8'   Y8P   '8'   888Y
              '8o          V          o8'
                `                   `
    The image is also reproduced a bit later at tx 959a19729ca02b1e06e600a331d7f4603669a7eaaa20b5cfb9f3528e3005a8f2, block 410357 www.blockchain.com/explorer/blocks/btc/410357 (2016-05-05). This second one includes the lyrics:
    Denk niet wit, denk niet zwart.
    Denk niet zwart-wit
    Maar alleen aan de kleur van je hart.
    translation;
    Don't think white, don't think black.
    Don't think black and white
    But only by the color of your heart.
    of the 1984 song "Zwart Wit" (Black and white) by Dutch artist Frank Boeijen, sample performance by the artist:
    Video 1.
    Zwart Wit by Frank Boeijen
    . Source.
  •   ####################
      Transhumanism and###
      singularity are lies
      and tricks. Don't###
      let them brainwash U
      and become enslaved#
      to Mr. Computer#####
      It's not intelligent
      ####################
      The Angels Trumpet##
      lures to takes away#
      your free will######
      You loose emotions,#
      CREATIVITY, sanity##
      and true INNOVATION#
      You have been warned
      ####################
      Humans are not tools
      to abuse and discard
      They have never been
      and they'll never be
      ####################
      Love & cherish life#
      Don't give up ur <3!
      ####################
      Pray for the Victims
      Send them love######
      Heal Mr.Computer too
      ####################
      
    57bc317de1d9a1724b751a008951f76c79c0b787d47cb7561598cc62994237ab has a related one.
  • tx e10c958e199daf71ab31342d40e188380fe84f07abee6a11d02c274d5431902a (2016-05-26) via cryptograffiti.info ASCII typeface spelling "CrimsonHexagon"
    _________        .__                              ___ ___
    \_   ___ \_______|__| _____   __________   ____  /   |   \   ____ ___  ________     ____   ____   ____
    /    \  \/\_  __ \  |/     \ /  ___/  _ \ /    \/    ~    \_/ __ \\  \/  /\__  \   / ___\ /  _ \ /    \
    \     \____|  | \/  |  Y Y  \\___ (  <_> )   |  \    Y    /\  ___/ >    <  / __ \_/ /_/  >  <_> )   |  \
     \______  /|__|  |__|__|_|  /____  >____/|___|  /\___|_  /  \___  >__/\_ \(____  /\___  / \____/|___|  /
            \/                \/     \/           \/       \/       \/      \/     \//_____/             \/
                                       http://smarturl.it/spacetransient
    The URL redirect is dead as of January 2024. Possible meaning: en.wikipedia.org/wiki/Crimson_Hexagon
  • ...........................................................  .......................................
    ........................................................?$OOZZOZ:. .................................
    ......................................................?8I~,....,,=,.................................
    .... .................................................8~~~:::,,,,,~=................................
    ~~::,.................................................==~~~:,,,,:,:I=...............................
    ::~~~::,,............................................:=====$8D+:~:~$7+ .............................
    ,,,:::~~~::,... .....................................:IDD8DI$Z7$?=?$7+..............................
    ,,,,,,,,::~~::,,....................................8?$Z$N:++?+=~~~~?~..............................
    ,,,,,,,,,,,,::~~::,,.. .............................. =+D=,:=7+~:::=~=~.............................
    ,,,,,,,,,,,,.,,,:::::,,...............................+?7OIO8ZZ?~~+7+~,.............................
    ,,,,,,,,,,,.,,.,..,,:::::,,.. ........................?$NDD$ZODD=+?II,..............................
    ,,,,,,,,,,,,,,,.,,....,,,::::,,... ..................,+8N$I$IZZOI$7I+O..............................
    ,,,,,,,,,,,,,,.,,........,,,::::,,....................$8DD8O7?78OZ$I+,..............................
    ,,,,,,,,,,,.,.,..............,,::::,,................ .D88ZZOZOOO$I+~+..............................
    ,,,,,.,,,,,.,..............................,............888D8O8Z?+==~:.............................:
    ,,,,,,,,,,,,.,.............................,..............?$OI?+++=+....$+.....................:::::
    ...........,,,.................... .......................??+??++??..,.D8O$Z?..............,::::::::
    ...........,,,...........................................IM7I??II+..,.ND8D88ZZ$Z$7......::::::::::::
    ,,,,........................... ......................?7,D77$77I?7O,.DDND8888888.....:::::::::::::~:
    ,,,,,... ...................... ..................~ZOZ8.DN7?++Z?+IM=NNNDD88NDDN..,.....:::::,:~~:,,,
    ,,,,,,,..........................................O88NDDDNN+~=~==+NMMNNDDDNNNDD=,........,:~~,,,,,,,,
    ,,,,,,,.........................................$DDDDNNNNNI~~7~=MNNNNDNNNNNDD8,..,,......,,,,,,,,,,,
    ,,,,,:,... .. ..................................8DNNDDNNNNN::,?NNMNNNNNDDNNND7.:..,,......,,,,,,,,,,
    ,,::::,... .....................................DDDNNNDNNNN7,DNNNNNNNNNNNNDDD=,~,,,,,.......,,.,,,,,
    ::::::,........................................,DNNNNNNNNNNNDMNNNNNNNNNNNNNND,,,.,,,,.......,,,,,,,,
    ::::::,........................ ......... .....,NNNNNNNNMNNDMMMMNNNNNNNNNNNMN,,,,,,,,,.....,,,,,,,,,
    ::::::,.....,..................................+NNNNNNMMMMDNMMNNNNNNNNNNNNNMMN~=,,,,,,.,.....,,,,,,,
    ,,,,,,,,..................... ................:~NNNNNNNDNMNNNNNNNNNNNNNNNNNMMMD?,,,,,,,.......,,,,,,
    .....,,,....,................ ................::NDDNNNNNNMNNNMNNNNNNNNNNMMMMMMMM::,::,,.....,,,,,,,,
    .....,,,.....................................,::~NNNNNNMMNNNMNMNMNMMMMMNNMNNNNMM~:::::,,,....,,,,,,,
    ~~~~~~=:..................................,::,:::=NNNNMMMDNMMMMMMMMMMMMMMMMMNNMM?~:::::,,,....,,,,,,
    ?+????I~..............................,:::::::~~~~DNNMMMMNMMMMMMMMMMMMMMMMMMMMMMM~~:::,,,,...,,,,,,,
    ???????:...........................,::::::::::~~~~?DMMMMMN8MMMMMMMMMMMMMMMMMMMMMM~=:~:~,,,....,,,,,,
    +++++++:...,.,,..,,,,..,,,......:::::::::::,:~~~~=~OMMNNMMMMNMMMMMMMMMMMMMMNMMMMMZ==~~:::,....,,,,,,
    +++++++:.,..................,:::::::::::,~~:,~~=~+~7MMNMMNNMMMMMMMMMMMMMMMMMMNMMMM?++~~~::,...,,,,,,
    ++++++=:.................,::::::::::,:~~:,,,.~~=~+=DMNNMNMNMMNMMMMMMMMMMMMMMMMMMMMO+=:=~~~:,..,,,,,,
    +===+==:.... .........:::::::::::,:=~:,,,,...:===+=DNNNMDMMMMMMMMMMMMMMMMMNNNMMMMMM7=+?=:~,::,,,,,,,
    ====+==:,:,,,,,,,,,:::~::::::::~=::,,,,,.....~~++???NNNNDMMMMMMMMMMMMMMMMMMMNMMMMMMMI?=:~~~:.,.,,,,,
    ====+===~::::::~::::::::::::~=::,,,,.........:~??77$NMNMNDNMMMMNMMMMMMMMMMMMNNNMMMMM$$I+,~:::::,,,,,
    =======~~::::~~~~:::::::~=~:,,,,,,,..........:~=++7ZNNNMNMMMMMMMMMMMMMMMMMMMNNMMMMMNNI~=,:,.....,,,,
    =======~::~~~~~~~~:::~=~:,,,,,,,...,.........=+~+?ZONNNMNMMMMMMMMMMMMMMMMMMMMMMMMMMMD~~,,:,,:,:,,,,,
    =====~~~~~~~~~~~~~==~:,,,,,,,,,,,...........,:~=+IZONNNMMMMMMMMMMMMMMMMMMMMMNMMMMMMMD~:~~::,..,,,,,,
    Dr. Bill Maurer
    Economic anthropologist
    Code 3.
    ASCII art of Dr. Bill Maurer
    .
    tx 06d2528cfabf360c7a8f925d84207d47612cd0ac1ad2efd8aea9758263d9738b (2016-07-13) via cryptograffiti.info entitled:
    Dr. Bill Maurer
    Economic anthropologist.
    His university home page faculty.sites.uci.edu/wmmaurer/ describes himself as:
    Professor Maurer is a cultural anthropologist and sociolegal scholar. His work explores the technological infrastructures and social relations of exchange and payment.His Wikipedia page: en.wikipedia.org/wiki/Bill_Maurer.
    Figure 9.
    Photograph of Dr. Bill Maurer
    . Source. Off-chain reference image for the ASCII art taken from his university home page: web.archive.org/web/20231109222608/https://faculty.sites.uci.edu/wmmaurer/
  • tx e35a9a198b77ece71272b66f94f9329184c6e4ee48e9e768e54ee8caf5d471fb, block 425758 (2016-08-18) via cryptograffiti.info has a dark one:
    killyour
    children
    setthemz
    free.il+
    6(\___/)
    6( O_O )
    6 `---`%
    evlbunny
    here)to@
    rule^you
    which reads:
    Kill your children, set them free. 666. Evil bunny here to rule you.
  • github.com/cirosantilli/bitcoin-inscription-indexer/blob/master/data/out/0437.txt#L1937 tx eede99ab9b50aa5871fcb4b1d0d1a22ac2fa94b08172b1fa677f0b200e96f84a blk 437669 (2016-11-06):
        __  / __
       / * `'   \
       \        /
         ._,.__,
    APPLE BAKE '16
  • ____________________________________________________
    |                         AA                         |
    |                       AAAAAA                       |
    |                      AAAAAAAA                      |
    |                    AAAAAAAAAAAA                    |
    |                  AAAAAA    AAAAAA                  |
    |                 AAAAAA      AAAAAA                 |
    |                AAAAAA        AAAAAA                |
    |               AAAAAA          AAAAAA               |
    |              AAAAAA            AAAAAA              |
    |             AAAAAA              AAAAAA             |
    |            AAAAAAA              AAAAAAA            |
    |           AAAAAAA                AAAAAAA           |
    |          AAAAAAAA                AAAAAAAA          |
    |          AAAAAAAA                AAAAAAAA          |
    |         AAAAAAAA                  AAAAAAAA         |
    |         AAAAAAAA                  AAAAAAAA         |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA        |
    |        AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA        |
    |        AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |        AAAAAAAAA                  AAAAAAAAA        |
    |____________________________________________________|
    Code 4.
    Study Math and Computer Science at Augustana College
    .
    Contains ASCII art of a large letter A. Has some custom encoding we didn't have the time to investigate which makes it deformed in our dumps, so we fixed it manually. The associated message reads:
    !Study Math and Computer Science at Augustana College!and so we understand that the ASCII art is formatted to look like the font of the logo of that university from Illinois.
    Figure 10.
    "Augie A"
    . Source. Off-chain reference image for the inscribed Code 4. "Study Math and Computer Science at Augustana College" typeface logo taken from the Augustana College website.
    Data Insertion in Bitcoin's Blockchain by Andrew Sward, Vecna OP_0 and Forrest Stonedahl is a paper published by some people of the university, presumably the culprits. This was brought to our attention via: twitter.com/ottosch_/status/1735297943563837726.
  • tx 12fba831eb6de8eb944e80e42c78d29cf05a833831a335a5711a4b61cf90802e (2018-04-06)
    Grishchuk Roman_____
    Pavlovich___________
    ________AND_________
    Gres Anna Leonidovna
    Married 01/04/2015__
    ====================
    =====++++==++++=====
    ====++===++===++====
    ===++====++====++===
    ===++==========++===
    ====++========++====
    =====++======++=====
    ======++====++======
    =======++==++=======
    ========++++========
    =========++=========
    Found by Messages from the mines.
  • tx fd739c26276ea81fea8210939d527fccd7c9622f93aa17d18ee0bd5321387fde, block 517406 (2018-04-09) contains the first line of an ad from American stockbroker company TD Ameritrade. It is encoded one line per transaction with OP_RETURN, but the ordering is completely scrambled. A link is given: TDAmeritrade.com/Blockchain but it is 404 as of January 2024 of course, companies can't keep their pages up for more than 3 seconds, but there is an archive which decodes the indented picture for us, including the corresponding tx hashes for each line web.archive.org/web/20180902001329/https://www.tdameritrade.com/landing-pages/offer/blockchain/index.html?cid=TVTDACDDRTVJ64, here is a copy from the website because we were lazy to double check each line:
    .............See the full picture at TDAmeritrade.com/Blockchain................
    ................................................................................
    ................................................................................
    ................................................................................
    .......................................................................^V^......
    ........XXX......................................................^V^............
    .......XXXXX....................................................................
    ........XXX=====================................................................
    ........| | ....................\\..............................................
    ........| | .......................\\=========================..................
    ........| | ..................................................\\................
    ........| | ...................................................\\==========.....
    ........| | ...............................................................\\...
    ........| | ................................................................||..
    ........| |.................................................................||..
    ........| | XXXXXXXXXXXXXXX ................................................||..
    ........| | XXXXXXXXXXXXXXX ................................................||..
    ........| | X| .........\XX ....@ ..................* ..@ ..........@ ......||..
    ........| | XXX| @ XXX\  XX    @ @   @/@@@  @@  @/@ @ @@@ @/@  @@ @@@ .@@ ..||..
    ........| | XXX| @ XXXX| XX   @@@@@  @ @ @ @ /  @   @  @  @   @ @ @ @ @ / ..||..
    ........| | XXX| @ XXX/  XX  @@   @@ @ @ @  @@@ @   @  @, @    @@ @@@  @@@  ||..
    ........| | XXX| @      /XX ................................................||..
    ........| | XXXXXXXXXXXXXXX ................................................||..
    ........| | XXXXXXXXXXXXXXX ................................................||..
    ........| | ................................................................||..
    ........| | ................................................................||..
    ........| | ................................................................||..
    ........| | ................................................................||..
    ........| | ................................................................||..
    ........| | ................................................................||..
    ........| |===================== ...........................................||..
    ........| |.....................\\========== ...............................||..
    ........| |.................................\\==============================//..
    ........| |.....................................................................
    ........| |.....................................((((()))).......................
    ........| |...................................((((((())))).(((()))).............
    ........___..................................(((((((())))))(((()))))............
    ......./___)................................((((((((()))))((((()))))))..........
    ....../ | |..................................(((((((((((()))))))))))))..........
    _____ ..| ( )...................................................................
    ........| ( )...................................................................
            | ( )..............(().(()..............................................
    _____\__| ( )............((((())))))............................................
    ........| |.............((((((()))))))..........................................
    ........| |.....................................................................
    ........| |.....................................................................
    ....MMMM| |MMMMM................................................................
    MMMMMMMM| |MMMMMMM..............................................................
    MMMMMMMM| |MMMMMMMMMMMM...................................$.....................
    MMMMMMMM| |MMMMMMMMMMMMMMMM............................$$$$$$$..................
    MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMM....................$$$$$$$$$$$$$$$.............
    MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMM............$$$$$$$$$$$$$$$$$$$$$$$..........
    MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMM......$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$....
    MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$
    MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$
    MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$
    MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$$$$$$$$$$$$$$$$$$$
    MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$$$$$$$$$$$$$$$
    MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$$$$$$$$$$$$
    MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$$$$$$$$$
    MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$$$$
    MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$
    \\\\\\\\| |\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
    \\\\\\\\| |\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
    \\\\\\\\\ /\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
    \\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
    \\\\\ TD Ameritrade, Inc., member FINRA/SIPC. copyright 2018 TD Ameritrade \\\\\
    \\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
  • tx eda919b0a61b91c1fb030e6af314dfe5aaa6198416bfdaf8599d7f1a80c5d614, block 526446 (2018-06-07) starts an ASCII art spread across several transactions on different lines. Lines are completely scrambled, so either there is an index somewhere, or it was meant as a puzzle. This is the best we've managed to unscramble so far:
    ................................................................................
    ..............................@(..@@@@@@%@@,.@@@@@@@............................
    ........................@@@@..@@@@@(..@@@@@@@(.@@@@@@..@@@@@@@.@@@@..@..........
    ......................@.@@@@..,..........@@@@@@...@@@#..@@@@@@@..@@@.@@@........
    ....................@@@.@@@@..@....../......@@@@&..@@@..@@@@@@@@.@@@@.@@@.......
    ...................@@@..@@@...@..&@..@@........@@@%@@@..@@@@@@@@..@@@@@@@@......
    ...................@@..@@@..../&.@@@@@@@........@@@@@@..@@@@@@@..,@@@@@@@.......
    ..................@@..@@@@....@..@.@@.@@@.......@@@@@@.@@@@@@@...@@@@@@@........
    ..................@@..@@@@...@........@@@@......@@@@@@@@@@@@@..@@@@@@@@.........
    ...................@@@#.@@@@.,...................@@@@@@@@@@@@@@@@@@@@...........
    ....................@@@@.@@@@.@@............@.@@@&.....@@@@@@@@@@@@@............
    .....................@@@..@@@@.@@@........@.@@@.@@@@@@@@@,..@@@@@@@@............
    .....................@@@@...@@..@@@......@@@.@@@@@..@@@@@@@@..@@@@@.............
    .....................#@@@@@..@@..@@@@@@@@@@@.@@@@@@@..@@@@@@@.(@@@..............
    ......................@@@@@@@@@...@@@@@@@@..@@@@@@@@@..@@@@@..@@@...............
    ........................@@@@@@@@@........@@@@@@@@@@@..@@@@..@@..................
    ...........................@......%@@@@@@@@@@@@@@@@@@@@@@@@@....................
    ...............................@@@@@@@@@@@@@@@@@@@@@@@@@........................
    ..............................@@@@@@@@@@@@@@@@@......@@@........................
    ..............................@@@@.....@@@@@@...................................
    .............................@......@@@@@@................#@@@@@@@@@@@..........
    ..................................@@@@@@...............@@@@@@@..................
    ................................@@@@@................@@@@@@@....................
    .............................@@@@@.................@@@@@@@......................
    ...........................@@@@@.................@@@@@@@........................
    ........................*@@@@..............,@@@@@@@@@@@.........................
    ......................@@@@..........@@@@@@@@@@@@@@@@............................
    .........@@@@.....@@@@@........*@@@@@@@@@@@@(...................................
    ........@@@@@@@@@@@.........@@@@@@@@/...........................................
    ......@..@@@....@@@.......@@@@@@................................................
    .....@@@@@.@@#..........@@@@@...................................................
    ......@@@@@@@@@@@@@@@@@@@@......................................................
    ...................................................................===========/.
    .........................................................==========..........//.
    ................................................=========..................../..
    .........................................=======...........//XX...XXXXXXX...//..
    ...................................======.........XX..XXXXXXXXX.XXX........./...
    .........................=========........XXX....XXX..XXXX.......XXXXXXXXX..\...
    ...............==========............XXX.XXXXX...XXX..XXXXXXXXX....XXXXXXX..\\..
    \=============/..............XXXX....XXX.XXXXXX..XXX..XXX.......XXXX..XXXX...\\.
    \\..................XXXX.....XXXXXX..XXX.XXX.XXXXXXX..XXX../XXX..XXXXXXX.....\\.
    .\......XXXXXX......XXXXX....XXX.XXX.XXX.XXX...XXXXX..XXXXXXX................//.
    .\\...XXX...XXX....XXXXXXX...XXX..XXXXXX.XXX....\XXX....====================/...
    .\\..XXX..........XXX..XXX...XXX....XXXX.XX=....=======/........................
    ../..XXX..........XXXXXXXXX..XXX............===/..######...###...###..####......
    .//..XXX....XXX..XXX.....XXX.X......======//......#...##.###.###..##.##..##.....
    .//...XXXXXXXX..XXX.........======//................###..##...##..##..####......
    ./.................=======//......................###....###.###..##.##..##.....
    /================//..........T.I.T.A.N.I.U.M......######...###....##..####......
    ................................................................................
    ..................Duncan.Marshall-Founding.Partner-Droga5-USA...................
    ..................Gail.Heimann-President-Weber.Shandwick-USA....................
    ..............Susan.Bonds-Co-Founder.&.CEO-42.Entertainment-GLOBAL..............
    .............James.McGrath-Creative.Chairman-Clemenger.BBDO-AUSTRALIA...........
    ............Fred.Raillard-Founder,.Chief.Creative.Officer-FF-GLOBAL.............
    ...........Eugene.Cheong-Chief.Creative.Officer-Ogilvy.&.Mather-APAC............
    ..........Colleen.DeCourcy-Chief.Creative.Officer-Wieden+Kennedy-GLOBAL.........
    .......Caitlin.Ryan-Regional.Creative.Director-Facebook.and.Instagram-EMEA......
    .......PJ.Pereira-Creative.Chairman.&.Co-Founder-Pereira.O'Dell-GLOBAL..........
    .Jason.Xenopolous-Global.Chief.Vision.Officer.&.Chief.Creative.Officer-VML-EMEA.
    At firs we thought it was some kind of tribute to the Cannes Film Festival, but given the string "Titanium" and the fact that all people mentioned on another section of the art work for advertisement companies, we understand that it is instead almost certainly about the "Cannes Lions International Festival of Creativity", previously "International Advertising Festival", which has a "titanium" prize category, e.g. as mentioned at: www.thedrum.com/news/2018/06/22/cannes-lions-winners-titanium-glass-grand-prix-good-and-more:
    The highly coveted Titanium Lions - created to honor marketing work that doesn't fit neatly into traditional categories
    The part with the at signs '@' which we believe represents the lion is the hardest one and we've perhaps gotten some lines wrong, corrections are welcome.
  •                     `...:.
                      `''''';';
                      '+'''+''''
                      `'''++++''''
                      ;'++++';;'++,
                      '+++++';;;''+,
                      '+++++;;;;;++;
                      '++++'';;;;;+':
    ::::::,,,,,,,,...`+'''';;;'';;;;;` `````````````
    ::::::::::::::::::';'''';+++';;';:::::::::::::,,,,
    :::::::::::::::::::''';;''+'';;';:::::::::::::::::
    :::::::::::::::::::;''++'''';;;'':::::::::::::::::
    :::::::::::::::::::;+++++';'''''+;::::::::::::;:::
    :::::::::::::::::::::;'+'''''++'';#';:::::::::::::
    ::::::::::::::::::'+++''''''+''++'+'+;::::::::::::
    :::::;:::::::::::'+++++''++++''++'#++'':::::::::::
    ;;;;::::::::::::'+###++#'+++'++++'#+#++'';::::::::
    ;::;;;;;:::::::'++++++++#+++++++++#+++++++';::::::
    ;;;::::;;;:;;;;++++'''''+####+++++##;++++++';:;:::
    :::;;;;;;;::::+##';''''''###+##++##+;++++++++':;::
    :::;;;;::::::;+#+';''''''###++###+#+;###+++++'':::
    :::::::::::::#+#'''';''''+###+++####;##++++++++':;
    ;;;;;;:::::;:++++''++'''+####+++++##;#+#++++++++':
    ;;;;:;:::::::#++'#++++##++#++++++++#'###+++####++;
    ::::::;;;;;;;+++''''++'+++@+++++++'####+#++#+++++;
    ;;;;;;;;;;;;;;+#';'''''+'+##'+++++'+#####+++++#++;
    ;;;;;;::;:::;:'++'''+''+++##++'+''+#########+++++:
    ;;;;;;;;;;;;;''++'++'''++##+'+##++#+##+#+++##++++;
    ;;;;;;;;;;;'''''#++''''++##+###'#######+####++++;;
    ;;;;;;;;;;;;''''+#++'+++###'#+;'##+####+++#+++++;;
    ;;;;;;::;;'''''+'+##++++###'#';###+##+####++++++;;
    ;;;;;;'++'''''++++#++++####'+;+##+###++####++++;;;
    ;;;;:+++''''++++++#####@###'+;######+#++###++++;;;
    ;;;';;#+'''+++++++########+'++######+++++++++++;;;
    ;;;::;'+'+++++++++########''++##+##+++++###++++;;;
    ;;:+;''+++++++++++#+#####+''#+#+###+++#####+++';;;
    ;'';;+''+++++++++++######'''+######+++++###+++;;;;
    ;';;'''+#+++++++++######+'';#++############++#:;;;
    ;'';''+'++##++++++++####+'''###@########++#++#;;;;
    ;''''''+@++++#++++++####''+'##############++#;;;;;
    ;''''''''++++++++++++###''+'##############+##;;;;;
    ;'''''''''++++++++++++##+'''##############+#+;;;;;
    ;;;;''''''+###+++####+######################;:;;;;
    ;;;;+''''''+##############+#################;:;;;;
    Code 5. . 2017-05-27 via cryptograffiti.info. A low resolution man and a woman hugging looking forward, signed "B&E April 9". The image /s repeated at: tx 47fafaa96c24d3f204658fb4bec34ab6f18df138084e04535ea60cce8c4e4857 without signature.
  • tx 79947c26f8abc8d5c2a9b5442005a5426f35f436119b3092f59e6fe3fad80df1, block 530614 (2018-07-05) has this lolcat:
    lolcat test |\---/|
                | o_o |
                \_^_/0
  • tx f8102999c0aaf7681deec383eb8e7946f093e94a116a21e367e9ed6b7c32d1fb (2018-08-23) contains the logo of the GrrCon, an annual cybersecurity conference with message:
    Your free GrrCon ticket
    The actual code appears to be:
    OPRETURNISMYFRIEND
    a reference to OP_RETURN. It is steganographically encoded diagonally across the skull's eyes. Ciro Santilli only saw this after grepping:
    grep @ data/out/0538.txt
    which made all non @ signs stand out due to the terminal's syntax highligh. This image was uploaded one line per transaction with a few interruptions that we removed manually, and there were was a previous partial attempt a bit before: at tx f8102999c0aaf7681deec383eb8e7946f093e94a116a21e367e9ed6b7c32d1fb so either a failure, or maybe it was intentional to obfuscate things a bit.
    @@@@@@@@@@@@@@@@@@@@@@@@YOUR@FREE@GRRCON@TICKET@CODE@@@@@@@@@@@@@@@@@@@@@@@@@@@
    @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@,          *@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
    @@@@@@@@@@@@@@@@@@@@@@@@@@%                          @@@@@@@@@@@@@@@@@@@@@@@@@@
    @@@@@@@@@@@@@@@@@@@@@@                                   .@@@@@@@@@@@@@@@@@@@@@
    @@@@@@@@@@@@@@@@@@@          *@@@@@@@@@@@@@@@@@@@,           @@@@@@@@@@@@@@@@@@
    @@@@@@@@@@@@@@@@         @@@@(                   %@@@@          @@@@@@@@@@@@@@@
    @@@@@@@@@@@@@@       @@@@                             @@@&        @@@@@@@@@@@@@
    @@@@@@@@@@@@       @@@        @@@@@@@@@@@@@,@.           @@@        @@@@@@@@@@@
    @@@@@@@@@@      %@@       .&@@@@@@&%@@@@@&&&@@@@@#          @@/      /@@@@@@@@@
    @@@@@@@@@      @@       @@@&@@O@@@@@@@@@@@@@@@@(@@@@&         @@       @@@@@@@@
    @@@@@@@@     @@.      .@@@,%&@@P@@@@@(,*&*@@@@@@@@#(#.@        (@@      @@@@@@@
    @@@@@@*     @@       @@(@%@@@@@&R@@@@&@@@@@@@&@@@@@@/ @@@        @@      @@@@@@
    @@@@@#     @@       @@@@@@@@,,@%@E@%@@@@@@@@@@@%@@@@@.@@@@        @@      @@@@@
    @@@@@     @@        @.@@@@@,@@@(@,T@@@@@@@@@@@@@@@@@@@@@@@@        @@      @@@@
    @@@@     @@        @&@@@@@@/@#@(@&@U@@@@@@@@(@@@@@@., #@@@@@        @@      @@@
    @@@*    @@         @@@@&@@&@    #@@@R@.@@@@@.@@@@@@@%@@(@@@@@        @@     @@@
    @@@     @@         /@@*@@        @@@/N/@,@@@@@@@@@    @@@@@@,        @@      @@
    @@@    @@          @@@@@          @@.@I@@,@@@@@@@@    @@@@&@@         @@     @@
    @@/    @@           @@@,           (#@/S@@@@@@.,@     **@@&,@         @@     @@
    @@     @@           %((           @#@@@@M@@@@@&@    #./%&@@*          @@     %@
    @@     @@           #&&@          @@@@&@@Y@@@@@     &@,@@@.(          @@     %@
    @@,    @@           @@@@@@        *(@@%@@@F&@.      @@&%@@            @@     @@
    @@@    @@           @#@%@/@         @@@*@@@R(      @@@&@              @@     @@
    @@@     @@         @@@@@@@@@%@@@%%@@@@@@@%%/I@  @@@@, @              @@      @@
    @@@.    @@         @@@@@@@*@&@@@@# @(@@@@@@@@E@@@@@@@&               @@     @@@
    @@@@     @@         @@@@&@@(@@@@@@.@# @@@ @@@@N@@@@,@(              @@      @@@
    @@@@@     @@            @@@*@@&@@*(@  @@@&@@&@@D@@@@&              @@      @@@@
    @@@@@.     @@                  @/@,@@@@@@@@@@@@@@%                @@      @@@@@
    @@@@@@      @@                 @@@@@@@@@@@@@,@@@@                @@      %@@@@@
    @@@@@@@,     @@/             @&@@(@@@@ @@@@@@@@@               &@@      @@@@@@@
    @@@@@@@@@      @@          #%@(,&,@@@@ @(&  @/,@              @@       @@@@@@@@
    @@@@@@@@@@      /@@        @@&@@@@@,*  @@&  @@@@@@         .@@.       @@@@@@@@@
    @@@@@@@@@@@@       @@@        @(@@@@@@ @@@  .@(@@,       @@@        @@@@@@@@@@@
    @@@@@@@@@@@@@@       &@@@                             @@@#        @@@@@@@@@@@@@
    @@@@@@@@@@@@@@@@         @@@@@                   @@@@@          @@@@@@@@@@@@@@@
    @@@@@@@@@@@@@@@@@@#          .@@@@@@@@@@@@@@@@@@@            @@@@@@@@@@@@@@@@@@
    @@@@@@@@@@@@@@@@@@@@@@         @  ,        .  @           @@@@@@@@@@@@@@@@@@@@@
    @@@@@@@@@@@@@@@@@@@@@@@@@@     @ @   @#   @  *, @     @@@@@@@@@@@@@@@@@@@@@@@@@
    @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@&              @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
    Code 6.
    Your free GrrCon ticket
    .
    Without @s to better highlight the code:
                            YOUR FREE GRRCON TICKET CODE
                                      ,          *
                              %
                                                             .
                                 *                   ,
                                 (                   %
                                                             &
                                               , .
                    %         .&      &%     &&&     #            /      /
                               &  O                (    &
                   .      .   ,%&  P     (,*&*        #(#.         (
          *                ( %     &R    &       &      /
         #                      ,, % E %           %     .
                         .     ,   ( ,T
                        &      / # ( & U        (      ., #
       *                   &  &     #   R .     .       %  (
                       /  *             /N/ ,                   ,
                                        . I  ,                &
      /                    ,           (# /S      .,      **  &,
                        %((            #    M     &     #./%&  *                 %
                        #&&               &  Y          & ,   .(                 %
      ,                               *(  %   F& .        &%
                         # % /             *   R(         &
                                %   %%       %%/I       ,
       .                      * &    #  (        E       &
                            &  (      . #         N    , (
                               *  &  *(      &  &  D    &
         .                          / ,              %
                                                ,                            %
           ,       /              &  (                             &
                               #% (,&,      (&   /,
                    /            &     ,*    &                 .  .
                                   (            . (  ,
                         &                                   #
    
                      #          .
                                      ,        .
                                          #      *,
                                    &
  •   .,:x, .. ..;   'll' .;c;,..      ...'...::;;':coc.'o0xxxO00Ox;l:,',l.,;,,;c
        :'x;.'':::c;,..::,;ddddl:;'.   .':.'...,;:c,:,:.:''0kkk0000k'.   .l,,:;;c:
        c'kcckOOkxdl:;:clokOOkkxdolc:,..;..,';';cc:;c:l.'..xkxxOO0Ox'...,:ldc:.''.
    ...c:xOKKKKKOxocodxOKKKK00Okddl::;'. ..;'''cl.'ldxxdlcolddddoll:,;;',,d:;'...
    ..  cxOKXNNXXOxkxk0KKOOO00OOkxdolcc;,'. ,'..'ooOKKOkolk00000OkkkOkdl:'.c''...,
        :0XNNNNXO00KKKKK000kdk0OOOOOOxoc;,:'...;dKKXKKOxok0XXXXXKKXXKK0kxlccc'.,,'
      lOOXXNNXKKKKK0OkxdkOKOox00KXXNNXXKOdl',dKKKKKKK0kxxOXXNXX0OxlcllodkOkxc';;:
      cKO0XNNX0kddolccc::cldxxdOKXXXNNNNXOkxoNNNNNNNNNXK0Oxxkkxoc:;,,'...':x0Oc,,;
    .'0KKKXKOdlcc:::::::;;::cccclloxOKXNNNOxKWWWWNNNNKOxdoocc:::;;;,,'...  .ckOl';
    .dKXK0Kklcccc::::::::::;;;;;;,,,:ld0XNXXXWWWNNNKxolcc::::::;;;,,'...     ;xOc
    0KKO0klc:::::::::::::::;;;,,...,:coOXXXNWWWNXOdlllcccc::::;;;;,,,''..... ,kx;
    ,KXKKOdcc:::::;;;;::::;;;,''...',;:cxKNXWWWNXOxdoollcc:::::::::::clxkkdlc;..o,
    lXXKOolcc::::::;;;;;;;;;,'......,;:cd0NNWWWX0xddoolllcccccccccccokOOkxdol:. 'c
    'KXklcc::::::cc::::;;:;;;;,',,',;;:lokXNWWWXOkddoollllooodoolcccoxk0KKkd:;...;
    kNxllooddxddooooollllllcc:,,,;;;;;cod0NWWWNKOxdooloxO0000Okdl:;oodxxdol:,'.
    ;d0kdOO0000KKKKK0OkxoooxkkkkkxxdddlloxkXWWWWN0kdxk0K000KKKK0Oxl::;;clc:;,,...
    .k0OOxO0KKKXNNXXXK0xlccxKXXKKK00OOOOOxkNWWWWWX000OO0KXXOkOOxkddl:....;;;,'....
    ddklxodxkkO0000000KkoloO0KKKXXXKK00OkO0XWWWWWXK000KK00Okxxxdxxxoc,..'lolc::;,.
    xodlodllllodddddxOkl:,,dOxkkkkkxxddddO0NN0KWWWXK0OOkkxddoooodkkxl:;...:ddolc:;
    dllollooooooooodxocc:''cddllllllllloxxONNlcNWWNK0xdddoolllloxOxkxolc;:lccodxdl
    O0ddooolllllloooolc::,';cddolllloodddxKXNdk0NNNX0kxddoolllooxOO0KK0kooc:::ldxo
    NNNdddlllllllodolllccc::cldollllllodxO0K0dxxk0XNX0OkxxddooodxxkOOOkxolcccooooo
    NNNxxxdooooodddk0K0kxkkOOxddoloooodxk00OxdxxxxxOXX00OkkxxdddxdxxxxkkkOkxoc::cc
    NXKkxxkxdddddoodxkO0KKOkkdoodddoodxkOkkxxxxxxxxxxOK0000Okkxxxk00KK0Okxxxoc:;;,
    XKXKxxkkxxxddddddxxkOOxddoooododdxkOOdxddddddoooddddk0K00OkxxkkkkOOOkkxdlc;,'.
    KXXW0OkOkk000OOOOOOOkkOkxxxOkkxxxkkOdoooooolooolooodxk0K000OOkkkxxxxdollc:;,,'
    KXXWWX0O0OkOkOOO0O000OO00OOkOOkkOOOdooolooooddooooodxdxKKKK000OOkxddoollllccco
    KXXWWWNK0KOOkxxxkOOOOOkxddoodxOO0OdddddddoddoddoddodxodXNNNXKK000OOkxxdddxxkKX
    KXWWWWWWNKKOkkxxxxxxxxxxdddxxOO0XXdlloodolooddodldooxox0XNNWNNNNXXXXKKKKXXXXXK
    XWWWWWWWWWXKOkxdoooooooooodxO0XWWWOloodolddddololllloOXWNNNNNNNNNNNNNNWWXXXXKK
    WWWWWWWWWWWWX0Okkxxxxddddxk0KXWWWWXdcooocllllll::ccoXWWWWNNNNNWWWWNNNNNNXXKKKK
    WWWWWWWWWWWWWWXKKK000OOO0KXNWWWWWWNOlllollocl:lllkXNWWWWWNNNNNNNNNNNNXXXKKKKKK
    WWWWWWWWWWWWWWWWWWWWWWWWWWWWWWNWWWNXloccxdxkoldOXNWWWWWWWWNNNWNNNNNNNNXXXXXXXX
  • kkkkkkkkkkkkkOOOO0000OOOkdc:,''...  ............';oooodxdx0K0OKKXXXXKKNNNWWWNW
    kkkOOOOOOOkkOOOO000K00Oxc;'.''...  ...............':lodOxxKK000KKKKKKXNNWWWWWW
    0kkkkOOOK000000KKKKKKOl;,'...,'..  '.     ..........,ckKdx000000KKKKXNNWWNNWWW
    OOOOOOOOXNXXXXX0kkOxd:,'........  .,.      ...........cddk000000KXXNWWWWWWWWWW
    XXKXXXXXKKKKKKKKKXKx;'....   .... .:.   ............. .;oOXNNNNWWWWWMWWMMMWMMM
    OOOOOOOOOOOOOO0OOOx;.. .      ....':..  ......  ...  . .,OXXXXXXXXXWWWNWWWWWWW
    xxxxxkkkkkkkkOOkkx:..       .';:c:,;;...'...      ..    .:k0000000XNNNNWWWWWWW
    xxxxxkkkkkOkkkO0Kd..      .,:odxxkkxkOxoc,.              .o00000KXNNNNNWWNWWWW
    xkxkkkkOOOOO00KOkc.      'clldxxxkkOO000Okxl:'.           ,kO000KNNNNNWWWNWWWW
    xkxxkkkO00KKK00Ok;.      ,loddxxxkOO0000OOkxxdl;.         .d00000XNNNNNNNNWWWW
    kkkkOO0KKK00OOOOk'.     .,:cldxxxkkkOOOOOOkxdlc:,..        o00OO00KXXXXXNNNWNN
    00KKXXXKKKKKKKKKO;      .;cc,'.'cldxxkxdoc,',cll:,;.     .'OKKKXXXXNWWWWWWWMMM
    NNNNNNWWWWWWWWWWNk    . ':c:cl;cdoclxkdlooo;ccclcc;.    ..x00KKKKXXXKKKKKXXKXX
    kkkkkkkkxxkkkddooo:. .. 'clllooodolcdxoodddddooolc;.   ...O00000000000OO000OOO
    xxxxxxxxddkkkxdolll:'.  .clooddxxolldxoodxkxxxdool;.  ..'.xxkkkkkkkOOOOOOOOOOO
    oooooodddodddol:;;;:..   ,loddxxxllldxlloxxkkxddoc;.   ..lXXNNNNNWWWWWWWWWWWWW
    oooooddddddxxxxdddxd..    ;lodxddccokxlolxddxxdoc:.    ..lONWWWWWWWWWWWWWWWWWW
    00000KKKKXXXXXXXXXXXl; .  .;colloollododdddllolc:,     .....:kNWWWWWWWWWWWWWWW
    XXNNNNNNNNWWWWWWNNNXx,.    .;collcclodolllooolcc,      ...    .:xOOkkkkkxxxddd
    NNNNNNNXXXXKKKKKOkx'..  .   .':lolccccclodddol:'                .:lccccccccc::
    ooooooodddddddoc;'...   ....  .;loooddddxddlc;.           ..,:loool:::c:::::::
    lllllllllloll:,,'....... .      .:odddxdol;'.        ...'coooooooooo::::::::::
    ccccccccclcc;'''''..              .',;;'.                .';coolollod::::::;;;
    :::ccc::;;,.....                                              .',:cllo:::;;;;;
    :::,'.'...                                                         ..,c:;;;;;;
    ;......                                                               ..';;;;;
    ccc.                                                                     .,,,,
    cc.                                                                       .',,
    .,                                                                         .,,
    _______________________________________
    |         An immutable poem             |
    |    Unchanging over time, forever      |
    |   Written in transactions flowing     |
    |                                       |
    |     Unbroken blocks for a Rose        |
    |     That I found in September         |
    |   Freedom gives this simple prose     |
    |     For all our time together         |
    |                                       |
    |      Thank you for being you          |O
    |    Like this poem, it is forever      |,
    |     After all these years true        |
    |      I love our time together         |
  • tx b8e80f2bd1eac8c6db4dfb8b6cc9c8eb71133cbc1a0d32e6952c1a2818eecc8f, block 652005 (2020-10-09) contains the obituary for Yang Yiping, a Christian Chinese lady who lived in Germany:
           .-==-.
           |    |
           |    |
    .-====='    '=====-.
    |   Yang, Yiping   |
    *-====-.    .-====-*
           |   |
           | 杨 |
           |   |
           | 一 |
           | 平 |
           |   |
           |   |
           `-==-´
    *~~~~~~~~~~~~~~~~~~*
        Yang, Yiping
          杨 一平
    .~~~~~~~~~~~~~~~~~~.
      ✰ 1957-07-19
      ✞ 2020-10-08
    '~~~~~~~~~~~~~~~~~~'
    Wir vermissen dich!
     杨一平,
      我们思念你
       ヾ( ̄▽ ̄)
        杨一平与
         耶稣在一起
    //yang.yiping.de/btc
    Translations:
    • Wir vermissen dich: We miss you
    • 杨一平: Yang Yiping
    • 我们思念你: We miss you
    • 杨一平与耶稣在一起: Yang Yiping is with Jesus
    The link yang.yiping.de/btc is dead with no archives, but the toplevel yang.yiping.de survives as of 2024 and contais an obituary in a WordPress website. The Bitcoin message is acknowledged on the website at:
    archiviert auf der BTC Blockchain TX b8e80f2bd1eac8c6db4dfb8b6cc9c8eb71133cbc1a0d32e6952c1a2818eecc8f
    The website is also mirrored at yiping.de. The navigation is a bit confusing, but yang.yiping.de/?cat=10 contains a blog with many entries, presumably by her husband
    • the first post is from slightly before her death on 2020-09-01 and documents their 2019 trip to San Francisco apparently to visit family. She could be a COVID-19 casualty.
    • yang.yiping.de/?p=367 gives transliterated names of her three children: Kaibin, Ella and Martin
    • yang.yiping.de/?p=638 has some mentions of work colleagues, but not enough to easily identify where she worked
    Figure 13.
    Off-chain image of Yang Yiping
    . Source.
    A previous failed upload is present at: tx b4ba91b4892ff85a5eb18b85bc1fd744d9418b2a71f1dc130447893b9e1cab60, block 651974 (2020-10-09)
    The upload is done as P2PKH (20 bytes at a time) and is meant to show with newlines after each ouptut, BitLen style. It is also further broken down on our upload by the presence of UTF-8 characters. brando2131 helped decoded this message on Reddit, after Ciro Santilli reached out for help after seeing his work on the Code 9. "ZN inscription".
  • tx 0d034d6dc3cfa8c8ebb1df202ada251bdf890f9dd5f0c4dffbe185b8cc5c999d, block 669986 (2021-02-10) a teddy bear, also visible e.g. at www.asciiart.eu/toys/teddy-bears? "xoxo" means hugs and kisses. Maybe this was in preparation for St. Valentine's day a bit later on February 14th?
      ___
    {~._.~}
     ( Y )
    ()~*~()
    (_)-(_) xoxo, S
  • tx 7076d9a40b44e92d8b96f9f5f1cb258619356d0789fe5bcf5197e2eaeb2b9eab block 693550 (2021-07-31) contains what could be an obituary for a bird:
    YOU ARE
        _
        |o}=
        | (
      / /)
      /_//
    _/_//
    \/_'
    __LL
    SO FAT
    and tx b478c2a3566fa644ccb3c9da567f39c9030e337537610c9ff5c5c885ea6109b8 block 693776 appears to follow up on it:
      _    _
    /and\/so \
    | (o><-) |
    \//\ /\\
      V_/ \_V
      `\ / '
      loved
      Chris<3
    Cute.
  • tx 5c4f060e6166a530d891cafd0e9df42441d29b1ed9cff71a1652201b8d50bd72 (2021-10-27) TODO what does it represent? It seems so familiar... Decoded from our dumps with fold -w80 -s. It is encoded as a sequence of 43 OP_RETURN output scripts each containing 80 payload bytes each
               :d,                        ,do'                        ;d;
               :NNk;.                    .OWWk.                    .:OWK,
               '0MMWO:.            ...  .xWMMWd.  ..             .l0WMMk.
                dMMMMW0l.    .,coxO0Kd..oWMMMMNl .xK0kdl:,.    .oKWMMMWl
                ;KMMMMMWKo. .lXMMMMMX; :XMMMMMMX; :NMMMMWKc. 'dXMMMMMM0'
                 oWMMMMMMMXd'.'dXMMMNc ,0MMMMMMO. lWMMWKl..,xNMMMMMMMNc
                 .dNMMMMMMMMNx,..oXMMK; :XMMMMK; :XMWKc..;kNMMMMMMMMNl.
                   ;kNMMMMMMMMNk, 'kWM0' lNMMX: ,KMNd..:OWMMMMMMMMNx,
               .  '..,xNMMMMMMMMNd..oNMk..dNXo .OMXc .xNMMMMMMMMXd'.'' .'.
             ,ko..kXo'.,xXMMMMMMMWx..dWWd..;,..xWNl .OWMMMMMMMKo..,xNx..kO;
           .xNWo ,KMMXd,.'dXMMMMMMWl '0MNl    oNMO..dWMMMMMWKl..;kNMMO..xMNx'
          cKMMN: :NMMMMNx,..xNMMMMMO. dMMX;  :XMWl ,KMMMMMXo..:kNMMMMK, lWMMXc.
        .dNMMMNc '0MMMMMMNklOWMMMMMN: :NMM0dxKMMK, lWMMMMMNxoOWMMMMMWk. oWMMMWx.
       .kWMMMMMK:..oXMMMMMMMMMMMWNNNd .OMMMMMMMMk..kWNNWMMMMMMMMMMMKl..lXMMMMMWk.
       .;lx0XWMMNk,.'xNMMMMMWKd:,'.,'  dMMMMMMMWl  ',.',:dKWMMMMMNd..;OWMWNKkdl;.
     .coc,...,cokKKd..:KMMMNd. 'ldxd:. ,KMMMMMM0' .:dxdl' .dNMMW0; .okkoc;'..';coc.
     lNMMWXOxl:'..';,  ,0MWo   .',;::;. ;KMMMMK;  ,::;,'.   dWWk.  ....':ldOKNWMMN:
    '0MMMMMMMMMNKkdc;.  ;KX; ,xxdool;.   lWMMNl   .:loddkx, ;X0'
    .:lxOKNMMMMMMMMMMO.lWMMMMMMMMMMMMMMWXo. o0, .;loxkkx:.  .OMMO.  .:dxkkxo:. ;0c
    .kMMMMMMMMMMMMMMMMN:dXXXXXXXXXXXXXXXXXo  .c' ,c;'....',,. dMMd .;:,'....,:' ':.
    .dXXXXXXXXXXXXXXXXXl...................      dMMWNXXXNWK, lNNl ;XMWNXXXNWMd
     ...................xkkkkkkkkkkkkkkkOl..c;  .xMMMMMMMMMN: cXXc :NMMMMMMMMMx.
    ;; .okkkkkkkkkkkkkkkkdWMMMMMMMMMMMMMMMNc ,K0' .kMMMMMMMMMN: :KK: :NMMMMMMMMMk.
    ,0O. oWMMMMMMMMMMMMMMMXWMMMMMMMMMMMMMNKo..xWWk. lNMMMMMMMMX; .... ;XMMMMMMMMNc
    'OMWo .dKNWMMMMMMMMMMMMXNMMMMMMMNKOdl:'.  cNMMWk. lNMMMMMMMNOddddddONMMMMMMMXc
    .OWMMK;  .';cdk0XWMMMMMM00MNKOdl:'...;cl. '0MMMMWk. cXMMMMMMMWXKXNXKNMMMMMMMX:
    'OWMMMMk. ,ol;'...,cox0XWx,;'...;cok0NWWd..xWMMMMMM0, ;0MMMMXd,...'..'cOWMMW0,
    ,0MMMMMMWd..kWMNKOxl:,...,..;dk0NWMMMMMWk..oWMMMMMMMMK:
    .xNMMWOl,.....:xXMMNx..cXMMMMMMMMNc '0MMMMMMMWXOx: .xWMMMMMMMMMO.
    lNMMMMX0XWMMNl  cKMMMMWX00KNWMMM0: .xNMMNOxKMMMMX: ,0MMMMMMMMMWl  '0MMMMMMMWO'
    cXMMMMX:.oWMMMx.  .dNMMMMMMMMMMXd.  lWMMMX; cNMMMMK: ,0MMMMMMMMk.   :XMMMMMWk.
    lXMMMMMx..kMMMMd .c,.'dKWMMMMW0o'... cWMMMWd..kMMMMMK: 'OWMMMMM0'
    cXMMMNo..oNMMMMMK, cNMMMNc ;XXx;..,:cc:,..;xKc ;XMMMMX: ;XMMMMMXl..xNMMMK,
     :XWO; 'kWMMMMMNl '0MMMM0' oWMMWKxlc::coxKWMMx..kMMMMMO. oWMMMMMNx..:KW0,
      ,:..cKMMMMMMWd..xWMMMWo .OMMMMMMMMMMMMMMMMMK, cNMMMMWd..xWMMMMMW0:..:.
        .kWMMMMMMWx..dWMMMMK, lWMMMMMMMMMMMMMMMMMWd .OMMMMMNo..xWMMMMMMNd.
         :0WMMMMWd..oNMMMMWl '0MMMMMMMMMMMMMMMMMMMX; :XMMMMMNo..xWMMMMWk,
          .lKWMXl..xWMMMMMk. ,0WMMMMMMMMMMMMMMMMMNO,  oWMMMMMNd..lXMWO:.
            .ld, ,OWMMMMMK; ...:kNMMMMMMMMMMMMMXx,..' .kMMMMMMWO, ,o:.
                '0MMMMMMNc 'O0l..,dXMMMMMMMMMXd'.,dXXc '0MMMMMMWO.
                 .ckXWMWd..kWMMXd,.'dXMMMMMNx'.,xNMMMK; ;KMMWKx:.
                    .:dl..dWMMMMMNx,.'xNWW0: .dNMMMMMMK; ;xo;.
                         .cxOKNWMMMNd..:oc. :KMMMMWNKkd,
                             .;lxOKXNk.    :XNX0kdc,.
  • tx 71d9187cbb7b00b4c516df218499bbc301996262cfafc4533fd7916af1fb6315, block 709632, (2021-11-14) starts a consecutive sequence of transactions that encodes the characters 'Z' and 'N', an ad for the Zenon Network blockchain. This is the very first taproot enabled block, foreshadowing the great inscription boom that taproot would lead to, notably in the form of ordinal ruleset inscriptions.
        ,zzzzzzzzzzzzzzzzzzzzzzzz,      
                    .:1zzzzzzzzz.       
                  .:qqzzzzqqq,          
               ,;1zzzzzqqq,             
            ,;1zzzzzqqq,                
         ,;qzzzzz1qq,                   
        ,zzzzzzzzzzzzzzzzzzzzzzzz,      
    
        ,zzzzzq;.           1zzzz,      
        ,zzzzzzzzq,         1zzzz,      
        ,zzzzzzzzzz1:       1zzzz,      
        ,zzzzq:1zzzzzq;.    1zzzz,      
        ,zzzzq  ,qzzzzzz1,  1zzzz,      
        ,zzzzq    .;qzzzzzq:1zzzz,      
        ,zzzzq       ,qzzzzzzzzzz,      
        ,zzzzq         .;qzzzzzzz,  
    Code 9.
    ZN inscription
    .
    This ASCII art had been previously noted by sroose and decoded by brando2131 on Reddit, and was brought to our attention by Bagfoot OP446 on twitter. Ciro Santilli had previously spotted the art, but failed to decode it. "ZENON NETWORK" is inscribed just after the art confiming the meaning of the characters, but it does not appear in our ASCII dumps presumably because the string it is too short and surrounded by non-ASCII.
    Each line is encoded with OP_RETURN, is 38 bytes long, and starts and ends in 6 spaces, leading to 26 non-whitespace characters per line. The lines appear in scambled order and it is unclear if there is any logic in the ordering or if it was just meant as a little puzzle. But given the nearby "ZENON NETWORK" inscription, this decoding is overwhelmingly likely correct.
    The following lines also show up in our ASCII dump:
      ;4Fdzw1k=zzzzzzzzzzzzzzzz;      
      ,vtv3f5aKY0jGQglP9a1AGw==.      
      ;BynQtpeUyWTXKGTrGhdV2Q==;      
      ;tVMd3L1CKM4wFmyxEEEUV2bY;      
    They seem like Base64 encoded data due to the = sign padding, but nothing human readable comes out of them, so their meaning remains currently unknown.
  • tx cbf7cfb6c074e35e82ea604e2de6c82d00c168d7d7a1205383f93a6f40ee8520 (2022-01-24) ASCII typeface ad for Keepcase, some kind of Bitcoin hardware wallet. Manually converted to horizontal form to not take up too much space here.
    @@@@@@@@@@@@@@@@@@@V/@@@@@@@@@@@@@@@@@@@
    @@>                 @                   @.                  @,                  @'                  @;                  @^                  @''                 @:                  @>
             #          @   ###    ###*     @   ###########     @   ##########*     @   /###########    @   ###########*    @    /#########     @   ##########/     @   ###########/    \@@@@@@@@@@@@@@@@@@@
          #######       @   ###    ##       @   ###             @   ###.            @   ###    #####    @   ###/*           @   ###     *##     @   ####,           @   ####"           @///
      #####     #####   @   ########(       @   #########       @   ########        @   ##########.     @   ##<             @   ####### ###     @   *#########      @   #######         KEEPCASE : THE
    ###(   ####   ####  @   ###     ###.    @   ###\            @   ####            @   #####/          @   ###\.           @   ####### ##/     @        ####       @   ###_            ORIGINAL HARDWARE
    ###  ###  ###  ##   @   ###     ###\    @   ##########      @   #########/      @   ###/            @   \#########*     @   ###     #*      @  #########        @   ###########(    WALLET CASE
    ###  ##    ##
    ###  ###  ###   ##
    ###    ####   ####
      #####     ####*
          ######,
    @@>>
    A bit later we see another ad for the same company:
    Figure 14.
    keepcase.jpg
    . tx 6ea24c417d60a1c5312ca8ec0ab44bbdba2d79d84ceffa4c9455e02f89831d7f (2022-01-24) contains a data URL for a JPEG image:
    /@@@@@@@@@@@@@@@@@@@data:image/jpeg;base64,<base64 image> \@@@@@@@@@@@@@@@@@@@
  • tx 3c9216146bf1d9415ded8a1d03dd63fae8f0af2cbcaf68efaff4ad654a45b74d (2022-06-08) tiny face. The --BEGIN TRIBUTE-- format is a call back to BitLen, but they just don't do ASCII art like the old days anymore:
    ---BEGIN  TRIBUTE---
    ....!&&&&&&#####B!.:
    ...:GB5Y55555PG#&Y..
    ...^B7^::::^^~7P#J..
    ...:Y7??!^~7?J?JP!..
    ...:7!!?7~7???7?J!..
    ....^!^:~~7!^~77^:..
    :....!7!7???7?J!..:.
    ::...:7Y?77?YYJ!:..:
    :::::.~?JJY5Y77?Y5^.
    ----END   TRIBUTE---
    B5
  • tx 14e89fc01c367841f2d5c2786a3b051d67008be980694272530546a0452aeea9 (2022-07-05). ASCII typeface for:
    Chockchai Chawatcharaporn
    This seems to be aa Thai name, e.g. possibly www.linkedin.com/in/chokchai-thawatcharaporn-179398213/?originalSubdomain=th. And so we learn that Thai people are the coolest because their name can end in "-porn" which is awesome. The given name is:
    @   ###########*    @   ###    ###'     @    ########       @   ###    ###*     @   #########*      @   ###     ###"    @    /#########     @    ########/      @
    @   ###/*           @   ###    ###      @   ###    ###,     @   ###    ##       @   ##/*            @   ###     ###     @   ###     *##     @       ###.        @
    @   ##<             @   ##########      @   ###    ###]     @   ########(       @   ##(             @   ###########     @   ####### ###     @       ###,        @
    @   ###\.           @   ###    ###.     @   ###\   ###      @   ###     ##.     @   ##\             @   ###     ###.    @   ###     ##/     @       ###         @
    @   \#########*     @   ###    ###/     @    #######/       @   ###     ###\    @   ##########\     @   ###     ###/    @   ###     #*      @   /##########     @
    and the rest is just more of the same, just 10x longer. Manually converted to horizontal form to not take up too much space here.
Tip for ASCII art hunters:
grep -n -r '   ' . | sort
grep -n -r '@@@' . | sort
grep -n -r 'XXX' . | sort
grep -n -r '...' . | sort
E. Coli K-12 MG1655 Updated +Created
NCBI taxonomy entry: www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=511145 This links to:
  • genome: www.ncbi.nlm.nih.gov/genome/?term=txid511145 From there there are links to either:
    • Download the FASTA: "Download sequences in FASTA format for genome, protein"
      For the genome, you get a compressed FASTA file with extension .fna called GCF_000005845.2_ASM584v2_genomic.fna that starts with:
      >NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome
      AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG
      Using wc as in wc GCF_000005845.2_ASM584v2_genomic.fna gives 58022 lines, in Vim we see that each line is 80 characters, except for the final one which is 52. So we have 58020 * 80 + 52 = 4641652 =~ 4.6 Mbp
Jupyter Notebook Updated +Created
A waste of time. Output in my source files pollutes git and prevents me from editing it in Vim. Just let me run the freacking code and render images as standalone PNGs which I can include from Markdown.
Text-based game Updated +Created
Although Ciro Santilli is a big fan of plaintext files and of Vim, not so for games. Games must be easy to understand since they are just a toy.
Tilesets to the rescue!