Quick facts:
- Nationalities: Italian and Brazilian
- Grew up in: Brazil
- Relationship status 2017-: married
- Given name pronunciation: take your pick from Ciro Santilli's given name
- Chinese name: 三西猴, means "three western monkeys". Phonetic approximation to SANtilli CIRO. More info at: Ciro Santilli's Chinese name. Semi-unintentionally reminds Chinese people of Sun Wukong (孙悟空). This association is further slightly strengthened by the phonetic choice of 三 San, which Ciro later noticed matches the middle character of Tang Sanzang (唐三藏), the monk in Journey to the West. The given name 西猴 was given by Ciro Santilli's wife, then recent girlfriend, as a semi-joke, and he took it up because the best way to take a joke is to play along with the joker. 三 was chosen by Ciro himself.
- laptop: high end Lenovo ThinkPad
- distro: latest Ubuntu release
- Vim or Emacs: vi/vim. But for The Love, will someone please make an open source C++ integrated development environment that actually just works?
- tabs or spaces: spaces
- Mailing list or Git(Hub|Lab>): Git(Hub|Lab), with passion, see Section "Mailing list"
- system or unit tests: system
- programming languages: Python and C++. He'll learn Rust and Haskell once he's rich. As of the 2020s, Rust was picking up some serious steam, so Ciro might end up eating his own words there.
- musical instruments to listen: Chinese Guqin and electric Jazz-fusion guitar
- metric or imperial: metric, for The Love. Science? Standardization? 21st century anyone?
- QWERTY or Dvorak: QWERTY, alas
- birth name: Ciro Duran Santilli
Other people with the same name are listed at Section "Ciro Santilli's homonyms".
19th century illustration of the Journey to the West protagonist Sun Wukong
. Source. Sun Wukong (孙悟空) is a playful and obscenely powerful monkey Journey to the West. He protects Buddhist monk Tang Sanzang, and likes eating fruit, just like Ciro. Oh, and Goku from Dragon Ball is based on him. His japanese name is "Sun Wukong" (same Chinese characters with different Japanese pronunciation) for the love. His given name "Wukong" means literally "the one who mastered the void", which is clearly a Dharma name and fucking awesome in multiple ways. This is another sad instance of a Chinese thing better known in the West as Japanese.
It is worth noting however that although Wukong is extremely charming, Ciro's favorite novel of the Four Great Classic Novels is Water Margin. Journey to the West is just a Monster of the Week for kids, but Water Margin is a fight for justice saga. Sorry Wukong!
The photo was taken in an open event organized by the awesome Cambridge Synthetic Biology outreach group, more or less the same people who organize: www.meetup.com/Cambridge-Synthetic-Biology-Meetup/ and who helped organize Section "How to use an Oxford Nanopore MinION to extract DNA from river water and determine which bacteria live in it".
Taking part in such activities is what Ciro tries to do to overcome his lifelong regret of not having done more experimental stuff at university. Would he have had the patience to handle all the bullshit of the physical word without going back to the informational sciences? Maybe, maybe not. But now he will probably never know?!
Notice the orange high visibility cycling jersey under the lab coat, from someone who had just ridden in from work as fast as possible as part of his "lunch break". It is more fun when it is hard.
Scribe Jean Miélot, 15th century
. Ciro Santilli fantasizes that he would have make a good scribe in the middle ages, partly due to his self diagnosed graphomania, but also appreciation for foreign languages, and his mild obsession with the natural sciences.
OurBigBook.com is Ciro's view of a modern day scriptorium, except that now the illuminations are YouTube videos.
Chill and eat your bread in peace comes to mind. A scribe, in a library, reading and writing the entire day in peace and quiet. The life!
The job of a Internet-age scribe is basically that of making knowledge more open, legally extracting it from closed copyrighted sources, and explaining your understanding of it to the wider world under Creative Commons licenses on the web. And in the process of greater openness, given a well organized system, we are able combine the knowledge of many different people, and thus make things more understandable than any single/few creator closed source source could ever achieve.
Ciro once saw some cartoon on Wikipedia help pages of a turtle with a book in one hand, and typing into Wikipedia on its computer, TODO find it. That cartoon summarizes well the modern scribe life.
Another analogous version of this fantasy more in touch with Ciro's sinophily is the ideal of the Chinese scholar, notably including their stereotypical attributes such as mastery of the Four arts.
Ciro Santilli piling boxes as a child
. A natural born engineer.Ciro Santilli waving hello in infrared.
More info at: Figure "Ciro Santilli waving hello in infrared".Major projects can be seen at: Section "The most important projects done by Ciro Santilli".
These are some smaller projects that Ciro Santilli carried out. They are all either for fun, or misguided use of his time done by an younger self:
- small naughty stuff is listed at: Section "Ciro Santilli's naughty projects"
- Because Ciro cares about education, around 2014 he looked into markup languages and version control for books, before he noticed that this approach was useless and that ranking algorithms are all that matter:
- He implemented some large features and several smaller improvements.GitLab sent Ciro a free swag bottle later after they got funding on to thank him for his contributions: Figure 1. "Ciro Santilli in a dune lake in Jericoacoara, Brazil, with his GitLab bottle". He had to pay for the beach trip though.
Figure 1. Ciro Santilli in a dune lake in Jericoacoara, Brazil, with his GitLab bottle. - Markdown Style Guide
- karlcow/markdown-testsuite improvements: Ciro has implemented the test runner a few months before CommonMark left stealth mode and killed it instantaneously.At least MacFarlane was able to reuse part of the HTML normalizer he wrote, and he extracted the multi-engine comparison to: CommonMark Implementation Compare.Playing with this project has led Ciro to find and report many Markdown bugs/bad behavior on other software, e.g. GitHub and MultiMarkdown-4.
- isaacs/github public unofficial GitHub issue tracker: he has commented there so often that he was made a collaborator
- Node Express Sequelize Next.js realworld example app
- VCDVCD: value change dump command-line pretty printer!!! The type of thing that a billion dollar EDA tool vendor will never implement ;-)
0 time 1 counter_tb.clock 2 counter_tb.enable 3 counter_tb.out[1:0] 4 counter_tb.reset 5 counter_tb.top.out[1:0] 0 1 2 3 4 5 =========== 0 1 0 x 0 x 1 0 0 x 1 x 2 1 0 0 1 0 3 0 0 0 0 0 4 1 0 0 0 0 5 0 1 0 0 0
- Vim: sometimes Ciro want crazy and wasted his time with Vimscript:
- Vim Markdown: the owner
plasticboy
was really nice and made Ciro a collaborator for his contributions, notably a live ToC outline and the header mappings - Vundle Plugin Tester, which he used to start the testing system of Vim Markdown
- Vim Markdown: the owner
- Breakthrough Message: aliens!!! Creative/media project, powered by some Python scripts.
- making Google Maps reviews of places he's visited to help other people. Ciro's photos reached 1 million views in 2019: www.google.com/maps/contrib/106598607405640635523/photos (archive)
There are a few dozen ASCII arts in the blockchain.
ASCII porn is listed at Section "ASCII porn".
Almost all of them are copy pastes of stuff present elsewhere, or boring high resolution ones auto-generated from images. But hey, it's still fun to see.
- block 229417 (2013-04-03) has a cute one liner sword miner message by HHTT:
./SockThing/HHTT/o()xxxx[{::::::::::::::::::::::::::::::::::>
- 5acc5293506c65d346d6ca171d8e8b73b39b3f99fb16a98cc7f3ce9dbe27a87c (2014-03-10) goes straight to the point:
+----+ |fuck| +----+
- tx 9f17f3ce43019c24baa6d679edfdddeada856f617cd9c1f6008d49be4542b768, block 301412 (2014-05-18) TODO wft, what/who is "poutine". Cthulhu is of course the fictional (?) entity created by writer H. P. Lovecraft.There were a few small donations: www.blockchain.com/explorer/addresses/BTC/1JsJs5d6E5SmJSGUiQ12uF1GDZxTCUWvf
_--------. / ~~~~~~\ p o u t i n e (_ ~~~@~~@| Cthulhu wants your bitcoin/dogecoin, plz donate \ ~~//|\\\ | \ \|||/\\\_/ / /|//_/|/__ BTC : 1JsJs5d6E5SmJSGUiQ12uF1GDZxTCUWvf / \_\ \|\| DOGE: D93mn1utTc7REQQPjQSjFf9Boupm32gw88
- tx 7b537ad012439c6306dd74e13ba9c20926d68d04fc0c6da2fc81a8eb8f9ea017, block 322917 (2014-09-28) via cryptograffiti.info: hello, it's the Internet:
/\_/\ ____/ o o \ /~____ = = / (______)__m_m)
Figure 1. ASCII art of the Winklevoss twins. tx 09a5d5aaecdce1757e6ec713cc8a2201abca9acdb6fbadc7760e831cdad3d680 (2014-10-01) high resolution image of two men wearing a suit with the bitcoin logo on the background, followed by "if you like it, leave a tip: 1MDBHLGV7WX9viRG9X4LfDQfCX8oZ9w". Both men look quite similar, so quite likely it's the Winklevoss twins, who had a big and later catastrophic involvement with Bitcoin. The tip address appears to be cropped and is incorrect, ooops. 777db7bfbea2c525d5adb05a8fbf47736e2311492f4614e5d38ab199b4bbfac2 give the likely correct version of it "1MDBHLgv7WX9viRG9X4LfDQfCX8oZ9wviC".- tx e577e60f4008a00175ef3f3266f052949440009b2ac65e4957da114db29bf96d (2014-11-03)
@jamesmorgan
. Possibly this Twitter account: twitter.com/jamesmorgan but it was suspended as of January 2024. It had only a single archive from 2008 at: web.archive.org/web/20081007152024/http://twitter.com/JamesMorgan but nothing special about it besides the 2008 vibe of Twitter CSS:_____ __ / ___ \ |__|____ _____ ____ ______ ____ _____ ___________ _________ ____ / / ._\ \ | \__ \ / \_/ __ \ / ___// ___\ / \ / _ \_ __ \/ ___\__ \ / \ < \_____/ | |/ __ \| Y Y \ ___/ \___ \/ /_/ > Y Y ( <_> ) | \/ /_/ > __ \| | \ \_____\/\__| (____ /__|_| /\___ >____ >___ /|__|_| /\____/|__| \___ (____ /___| / \______| \/ \/ \/ \/_____/ \/ /_____/ \/ \/
Figure 2. . (2014-10-12). Associated text: Portrait of a young man. TODO identify. 1MDBHLgv7WX9viRG9X4LfDQfCX8oZ9wviC was tipped twice so far: www.blockchain.com/explorer/addresses/btc/1MDBHLgv7WX9viRG9X4LfDQfCX8oZ9wviC for 0.00240 BTC and 0.02490000 BTC in 2014.if you like it, leave a tip: 1MDBHLgv7WX9viRG9X4LfDQfCX8oZ9wviC
- tx c6df8850871fce6c8764af2a0a4155241fc987db57abd8c9ead0165895e1ccc4 (2014-11-04): TODO what company is this the logo of? It seems very familiar, Ciro Santilli has certainly seen it before but can't remember where...:
`-:+syhhhhhhyo/-. ./sdmmmmmmmmmmmmmmddy/.` :sdmmmmmdddddhhysyhhddddho-` -ydmmmmddddddddddhhyso++yhddh/`` +dmmmdddddddyso++/++shdy+:/+ydho`` +dmmdddddhhy:`` ./sh/.-/yhho` -dmmdddhhhy/` `/y/`./yho- .hmddddhhhs: :h.`::/-:` ydmmmdhhhy` s+ .` `.- ymmmmdhhh+ /o @R*. /mmmmdhhhs` .. `hmmmdhhhh/ ommmdddhhh- .hmmmddhhhh+-` .hmmmmddhhhhso+:----:+o+/:- :smmmmdddhhhhhhhhhhhhdddhh/ ` -sdmmmmddddddddddddddmmmd- .odmmmmmmmmmmmmmmmmmmd:` .-:odhmmmmmNNNNmdo/. ``-sooosyho`` -JGM
The Hashling /\|--|/\ /\|OO|/\ /\|--|/\ @BraveTheWorld @petertoddbtc
Code 1.The Hashling."The Hashling" presumably refers to a cute fictional crab-like animal that somehow inhabits the alternate reality created Blockchain network's incredible hashrate. Yet another soulless NFT collection would later be created with that name as well: magiceden.io/ordinals/marketplace/hashlings.But that is not all! Immediately after the ASCII art encoded as one constant, the remaining constants of the input script except for the last one encode a raw PNG image with a hand drawing of the creature:The last constant is then the only thing that matters and spends the incoming output.The ASCII art and image are also inscribed 16 more times on the blockchain: github.com/cirosantilli/bitcoin-inscription-indexer/blob/master/data/hashling. 453c9511ca76361c8c44b4302ce1b5d8d5c98a938b548478ef931baaa7d70e62 also has the image without any ASCII strings.Peter Todd is the author of Peter Todd's hash collision puzzles.@BraveTheWorld
is presumably twitter.com/BraveTheWorld, but it is less clear what are they.- tx 57a4edce05dee9012ff5991532e9aa02aef82ee8d3ebecb9f833c12bfbc708fe (2014-12-19) via cryptograffiti.info "MERRY CHRISTMAS! & HAPPY NEW YEAR!!" with a really ugly father Christmas with gift bag. Reproduced at: asciiart.website/index.php?art=holiday/christmas/santa where is is credited From:
Heather Classen <classen@aware.com>
, Date: 22 Dec 1994 17:00:58 -0600MERRY CHRISTMAS! __ _ __ ___ & _ __'.:;.:;.:;.:` HAPPY NEW YEAR! _'.:;.:;.:;.:;.:;.:` '.:. , :`,.,`;'/`__ _` _ '..:;.;'.:,.;.:;\ (_) -__ --_-_-_-__---_-) ( ) ____ (_- -__-_-__-____-__-) /####\ /\ | ,~~~' `~~~. %@ |#####\#| ) ><@> <@>< %@% |#######| / / %@p \######| ( * (_c) * ) % % .vvvvvvvv. |#####| \ '%@%@%@%@`, %@%@ .vvvvvvvvvv. /#####\ _ _ d%@ `----' @%@%@ \ _ _ _.vvvvvvvvvvvvv. ~~~~~~~ ':;.;%@@%@%@%@%@%@@%p /.:;.:;vvvvvvvvvvvvvvv. `.:;.' ':;.;%@@%@%@@%@%@%@%@ :: ____vvmvvvvvvvvvvvvvvvv. :.:;.:` ':;.:d%@%@%@%@%@%@@%@%.:;/####\/\.:;\mvvvvvvvvvvvv :.:;.:;` ';.;;.%@%@@%@%@@%@%@%@p.:;|#####\#|.:;\mvvvvvvvvvvvv. :.:;.:;./;.;;.;%@%@%@%@%@%@%@%@ ::.'\######|.:;\mnvvvvvvvvvvvv :.:;.:;.|:.;.;.% %@%@%@%@%@% % : mvv\#####|.:;.\mnvvvvvvvvvvv :.:;.:;/:;.;.:;.q%@%@@%@%@ %p.:;vv%mv|#####\.:;.\mnvvvvvvvvvv :.:;.:;|:;.:;.;;;%@%@@% %.:;.:;.vmnv. ~~~~~~ .:;.|mvvvvvvvvvv. :.:;.:/.:;.:;.:;.: o .:;.:;.:;.vv.:;/.:;.:;\.:;.|mnvvvvvvvvv. `.:;.|:;.:;;;.:;. .:;;;;;;;;;;;;;|.:;.:;.\.:;\mnvvvvvvvv. `::/:;;;.:;;.:; o .:;.;;.:;;;.:;.:|.:;.:;.:\.:;\mnvvvvvnm ;.:;;.:;;.: :;;;.:;.:;.:;.:;\.:;.:;.:;.:;|mnvvvnm. :::;.:;.:;. o ..:;.:;.:;;;;.;;;;\.:;.:;.:;.:|mnvvnm. :::;.:;;.: .:;;;;;;;;.:;.:;;;|.:;.:;.:;./mmvnm. ;.:;.:;.;. o .:;.;.:;;.:;.:;.:;.\________/mmmnm. :.:;;;.;;; .:;;.:;.:;;.:;.:;.:;.;.:;;;;`mmnn `#######HHOHHH########################### #######HHOHHH########################### '::;;;.;; o :;;;.:;.:;;.;;;;;;;;;;;.:;.:` H.Classen
- tx 69708943906eb32a320a5a450fed450b0f14b4e475a98bc74615962b68a0bc83 (2015-01-24) via cryptograffiti.info "All Glory to he HYPNO TOAD" signed "SSt" has an ASCII art of HypnoToad, a ficticius mind controlling frog creature from Futurama: Fandom, KnowYourMeme. The same ASCII art can be seen for example at: www.gotfuturama.com/Multimedia/AsciiArt/HypnoSebastian.shtml
,'``.._ ,'``. :,--._:)\,:,._,.: All Glory to :`--,'' :`...';\ the HYPNO TOAD! `,' `---' `. / : / \ ,' :\.___,-. `...,---'``````-..._ |: \ ( ) ;: ) \ _,-. `. ( // `' \ : `.// ) ) , ; ,-|`. _,'/ ) ) ,' ,' ( :`.`-..____..=:.-': . _,' ,' `,'\ ``--....-)=' `._, \ ,') _ '``._ _.-/ _ `. (_) / )' ; / \ \`-.' `--( `-:`. `' ___..' _,-' |/ `.) `-. `.`.``-----``--, .' |/`.\`' ,','); SSt ` (/ (/
- tx 0913d8125167f728cec1b95d27e6fc62a7a45af35eecfefd3b5000e367ee1468 (2015-02-01) via cryptograffiti.info: ASCII typeface add for an unsuccesful cryptocurrency with a link to its homepage zeit-coin.net:
_ _ _ (_) | (_) _______ _| |_ ___ ___ _ _ __ |_ / _ \ | __/ __/ _ \| | '_ \ / / __/ | || (_| (_) | | | | | /___\___|_|\__\___\___/|_|_| |_| http://zeit-coin.net
- tx 43b0bb63fc50ad1edbb17486dc44825e4dd642a952c699cc13958e010ba3d8a5 (2015-02-26) has a star of David. Possibly related news from the day prior: www.theguardian.com/world/2015/jan/25/jewish-leaders-europe-legislation-outlawing-antisemitism "Jewish leaders call for Europe-wide legislation outlawing antisemitism"The signature however appears ironic and could stand for "Zionist Occupation Government"
/\ / \ / /\ \ ________/ /__\_\________ \ ____/ /___________ / \ \ / / \ \ / / \ \/ / \ \/ / \ \/ \ \/ /\ \ /\ \ / /\ \ / /\ \ / /__\_\______/ /__\ \ /_____________/ /______\ \ \ / / \ \/ / \ / \/ HELLO FROM ZOG
Muy feliz cumple Manu! ---- The Fantastic Four Gang :-D ~?O8O7?I$O8888OOZZ$$$7?=~::::::::::::$$8ODZZZ7I,.....,8D88O88O88$I?=7ZO88DDDNDNN 7888DD888888888OOZZZ$$I+=~:::::~IONNNNNNMNNNMMNMN8~:.,:+888D88O$$$Z$OZOO8DDNNNNM 88DDDDD8D88888888OZZZZI?=~::~+ODNMNNNMNMMMMMMMMMMNNND~,:?D8D88Z$$$7Z$ZZO8DNNNNNN 8DDDDNDDD8888OOO8OOOOZ7?=~~+DDDND8NDD88NNNMNMNNNMMMMMND?ODDD888ZOOOOOO88DNNNNNDD DD8DDDDDDD88O8O8OOOOOO7?++DDDDD8DDDDD8DDND888NDDNNMMMNMNZ$8DDDDD8DDDDDDDNNNNNNND 88D888888D88888O88O8OZ$7O8DD8DDNNNDDDDDND8888NDDDNNMNNNNDDO8888DD8DDDDDDNNNNNNND 88D888888888888888888OZZO88DNDDDDD8D88OOOOO8DDNDNDNNNNNDDDOI+?$88D88D8DDNNNNNNNN 88D8888D88888888D8D8DO$O8DDNDZ77I???+?++++++IZO8O8O888OOD8D$,,,~Z8OO888DDDNNNNDD DDD8888888DDDDDDDDDD8ZO8DDD8$I??+++===~~~~::~~=+===+?I$Z8888=..,7$OOOZO8DDNNNNDD 888D88DDD888DDDDDDD8ZO8DDDDO7?+++++=~~~~~:~:::::::::::~~+$8D$..:78OOOZO88DDNNDDD 88O888D88OOOO8DD8DD$888DDNDZ7?+?+?++==~~~~:::::::::::,::~=88DI,+88888OOO88DD888O O88888DDOOOOOO88DD8Z88NDNNOZ7???+++===~~~::::::::::::::::~$O88OO8888DD8O888OZZZO 88O8D8888OZZO8O88DOODDNDDD8OI????++===~~:~::::::::::::::::?ZOOOOOO8OD8DDDDOOOZ7$ 88O8O888O8OOOO88DDO8D8NNNN8O7III?++===~~~:::::::::::::::::?ZOZOZOOO8DDDDDD8877$Z 8O8888D8O8DDDDDDDDO8NDDDNNZ7I???+===~=~~~~~::::::::::::::~?OZZZ888D8D8888888$$$$ 8O8D88OO88DDDNNNNDZDNNDDN87I?????I$7???++===:~~~~~~::::,:=IO$$O88DD8D888D8DDZ$$$ 8888OOZZZO88DDDDDDO8NDDNDZII??7Z8O88NNNDOI?++=++++++==~::=$8ZZ88DDN8DD8DDDHACKER DD88O$$7$ZOOOO88D87ODDDND7??I7$$7777$OOO8O$?+=+$88DDD8O7:~$8$$88DNDNNNDDNNNNNNND DDD8O$77$$ZZOOO8DIOZZ8DNZ???7$ZODDNMMI8$8ZI=~:+IZOZ7II+=?=78$$O8NDNNNNNDNNNNNNDD DDD8OZZ$ZZOOOO8ODI$7$O8D????III7ZZ$$7IIII77=::+?7OZNDOZ=?~IO7Z8DDDDDDNNNDNNNNDDD DNDD88OO88DD88DDNI$?I$OZ??????????+++?+??II+~:==?77$7???+~=$+7DNDDDDDDDDNDDDND88 NNDNNDDDDNDDNDNDD$I?O8IIII??++++++++===+??I+:::~=++=++~~~:=77ZNNDDDDDDDDDDDDD888 DDNDDDDNDDNDDDDDNNII77I?II???+====~=~==+???=::::~:~~=~~:::=$+NNDDDDDNDDDDDDDDD88 NNNNNDNNNNNDDDDDDD??+7??I??I??+==~~===+I??+~:::~::~:~~::::~?=DDNDDDDDNNDDDDDDD8D NNNNNNNNNNDDDNNDDN$?I?IIIIIIII??=+=+?I$I+I?=~~::==~::::::~=~NDDNDDDDNDDDDDDDD888 NNNNMNNNNNNNNNNNNNNO??I$I?II777I?+??777$8D8$?+NO=+=~::::~~~?NNNNNDNNNNNNNDDDD8O8 NNNNMMMMMMNNNNNNNNDNN8$ZI?II7$$7I7I77?I7ZZOO$I+==++=~~:~=~:MMNNNNNNNNNNNNNDDD8OO NNNMMMMMMMMNMNNNNNNNNDO7??III7$777I7I7IIII$$$?+=~=?====~~:+MMNMMMNMMMMNNNDDD888O NMNMMMMMMMMMMMMMNMNNNNDI??IIII$7I?I$$77$7I+=~~~~=?I==+==+?MMMMMMMMMMMMNNDDD8888O NMMMMMMMMMMMMMMMMMMMNND??IIIIIIII?+?8O+I~=~I=IZZ?I$?+=+=8MMMMMMMMMMMMMNNDD888888 NMMMMMMMMMMMMMMNMMMMMNN??I7777I77I=+?III+~:~:,~+?+I+++==MMMMMMMMMMMMMMMDDDDDDDDD MNMMMMMMMMMMMMMMMMMMNNN?I777777I7I??++?I?++=~~=~:~+=+++IMMMMMMMMMMMMMMMMNNNNMMMM MMMMNNNNNMMMMMMMMMMMNMM?I77777II77I???++?IIII+~~:~===++MMMMMMMMMMMMMMMMMMMMMMMMM MMMMMMMMMMMMMMMMMMMMMMN+II7$7$$77III???++++===~~~~=+++MMMMMMMMMMMMMMMMMMMMMMMMMM MMMMMMMNMMMMMMMNMMMMMMN??I77$7$$7$7I?+++==~~~~~~~~=+?MMMMMMMMMMMMMMMMMMMMMMMMMMM MMMMMMNMMMMMMMMMMMMZ=+??II77$$$$77777I+==~~~~~:~~=+?MMMMMMMMMMMMMMMMMMMMMMMMMMMM MMMMNNNMMMMMMMMMM:+?II???II77$ZZZ$$$$$II+===+~~==??MMMMMMMMMMMMMMMMMMMMMMMMMMMMM MMMMMNNNNNMMMMMM7:I?77I?IIII7$$ZZOOZ7$$$7I??III?++8NMMMMMMMMMMMMMMMMMMMMMMMMMMMM MMMMMNMNNNMMMMMM,:I?$$IIIIIII7$$ZZZZ88OZ$$$777I?+=NNMMMMMMMMMMMMMMMMMMMMMMMMMMMM MMMMMMMMNNNMMMMZ,,?7ZO7IIIIIII7$$$$$$ZOOOZ7????++=DMMMMMMMMMMMMMMMMMMMMMMMMMMMMM MMMMMMMMMNNMMM8:,,,,Z$7I?I??I7777$$$$$$7II?++++++,ZMMMMMMMMMMMMMMMMMMMMMMMMMMMMM MMMMMMMMMMMNDI,,,,,,,?7II?????II7777777I?+???++++.8MMMMMMMMMMMMMMMMMMMMMMMMMMMMM MMMMMMNNND=,,,,,,,,,,,.?????????IIII7I7I???++++=~.?MMMMMMMMMMMMMMMMMMMMMMMMMMMMM MMMN7:,,....,,,,,,,,,,,..??+++++?????III?++++++$.,..IDMMMMMMMMMMMMMMMMMMMMMMMMMM
Code 2.Muy feliz cumple Manu!tx 00d8871c1b3fb85912616bb2602b5a9869a345d9fa092f8454614c6158c83d10 (2015-04-08)which means: "Happy birthday, Manu", in Spanish, followed by Manu's face in medium resolutionMuy feliz cumple Manu! ---- The Fantastic Four Gang :-D
The given names of the other three of the "Fantastic Four Gang" are then given at Figure 4. "Viva la Revolucion! Happy Birthday Santi".Figure 4. Viva la Revolucion! Happy Birthday Santi.tx 1b35d4b9506ab80ec7fc5542f73271cbb72090aa3f70bfa77670f8bd43d072a7, block 378022, 2015-10-08) has a message:and starts a long chain of contiguous transactions that renders Santi's face twice in low resolution. They are encoded one line every two transactions with OP_RETURN:Viva la Revolucion! Happy Birthday Santi! Manu, Santi, Demi, Esteban
and we've decoded it manually in Vim.- first face: 1890addb8afaeb7eabfa9f0fe9bb3ab0bdfdbe939e407618d6e335d6fc3d376f to f06ae6f454dfb064088f87f0684a5a541374ae573e6a6323196facad53f992cb (both in block 278022)
- second face: cacf8b730bd299bf48f7eab2703dce2132ee6216bccd4d01f14493f5a12da6ba to ad5e4afdcf4b415a867ba5ae9171d5101042b2eee9a7d211906f468217ba6ef7 (both in block 378023)
Both blocks were mined by AntPool, so they weren't mining themselves to enforce ordering. So how is ordering assured? TODO are transactions actually contiguous in the block or are there other transactions interspersed? According to:many of the transactions are contiguous but we haven't checked all of them.bitcoin-core.cli getblock 00000000000000000baf6e3006fd05a1c5dbca3d430012180f8098cbe8b8ce22
Figure 5. Warren Buffet.tx 0fc0c50e410b62ee3a316135711116db6b4e728841c976f29ab85e2a41e0dcc3 (2015-08-02) Associated message:1P675gRxNwhFXgfuDu5yXwGDgwLDbXNJqz was never tipped so far: www.blockchain.com/explorer/addresses/btc/1P675gRxNwhFXgfuDu5yXwGDgwLDbXNJqz TODO what is "BM-2cUDAqyqcnksx7YDtgu2y72xDxcRjPeYfo"?if you like it, leave a tip: 1P675gRxNwhFXgfuDu5yXwGDgwLDbXNJqz BM-2cUDAqyqcnksx7YDtgu2y72xDxcRjPeYfo
This image was likely inscribed due to Buffet's general status as an investing God. Interestingly, in a twist of fate, Buffer would later come to strongly criticize cryptocurrency as worthless: finance.yahoo.com/news/warren-buffett-says-wouldnt-pay-175917403.html.Figure 7. . tx 467c075ee6edaa60f184d0683655f1f6d267efd98061872f167ef7ca9ca7c50f (2015-08-09). The eyebrows are a bit wrong, and he is a bit too young for the original series. Minor manual fixes were applied by Ciro Santilli, it is unknown why this was needed. - tx beeead7429cdb78f3bfe8a17d8e485a3a847b3e99a511a025bb49e2948af5058, block 378735 (2015-10-13) contains a happy birthday message:the Spanish part translates to:
To my dear friend Mariano, por muchos anos más de diversión!
It does not show well in our ASCII jumps because the non ASCII characters are UTF-8-encoded. Europeans... This is followed by the ASCII art with Marian's nerdy face in it:Here's to many more years of fun
which reads:_______ _______ ____ ___ _______ _______ __ __ __ __ _______ ___ _______ | || || | | | | | | || | | || |_| || || | | | | ___|| ___|| | | | |____ | | || | | || || _ || | | ___| | |___ | |___ | | | | ____| | | || |_| || || |_| || | | |___ | ___|| ___|| |___ | | | ______| | _|| || || ___|| |___ | ___| | | | |___ | || | | |_____ | |_ | || ||_|| || | | || |___ |___| |_______||_______||___| |_______| |_______||_______||_| |_||___| |_______||_______| `````` ``..---------------...`` `.--------------------------.` .-------------------------------.` .----------------------------------` `------------------------------------` .------------------------------------. ------------:+yo------+yo:-----------. ---------/shhs+:------:+shhs+--------. ``--------so$/:--------------:/os--------`` `.-------------/oso:------:ooo/--------------` .------------:ho:-:ohsssshs:--+h:------------. .------------so-----y+--/h-----+y------------. .-----------:-:h+--:oh----ys:--+h/-----------. .-------------/ooo/------:ooo+--------------.` `..------------------------------------..` .----------------------------------. `-----------.```....```.-----------` .------------.``````.------------` `-----------------------------.` `.-----------------------..` ``....----------....`` __ __ _______ ______ ___ _______ __ _ __ __ __ | |_| || _ || _ | | | | _ || | | || | | | | | | || |_| || | || | | | |_| || |_| || | | | | | | || || |_||_ | | | || || | | | | | | || || __ || | | || _ ||__| |__| |__| | ||_|| || _ || | | || | | _ || | | | __ __ __ |_| |_||__| |__||___| |_||___| |__| |__||_| |__||__| |__| |__|
which means:Feliz cumple, Marian
The message is encoded with OP_RETURN payloads across multiple transactions, 40 bytes per transaction. They actually managed to upload two almost fully consecutive transaction blocks and in the correct order. Could they be miners?Happy Birthday, Marian
Some of the payloads contain newlines, you are just supposed to paste all payloads together to form the image. Our reconstruction here is manual however, lazy to script it properly. - tx f6039915b829377849be87fc242303873e6574528db7916dd81ff44141b3560f (2016-04-27) via cryptograffiti.info contains some candles followed by poem that starts with:Is in Dutch of course, literally:
vaardig regulerend de orde van de dag
Given the date and language, it appears to be a reference to Koningsdag, Dutch national holiday that celebrated the birthday of their King at the time, King Willem-Alexander. Born in 1956, he would have been turning 60 at the time, so a nice round number in 2016 when these birthday candles were inscribed.skillfully regulating the order of the day
The poem also appears at: 2422215c9a6040c0e337bf1c1e9b2b32244a1e36f3dd3e79fb77592c90bbb5a8.) ` /(l /) ( \ / ( ) * ) ( , ) \#/ \#' .-"#'-. .-"#"=, ( |"-.='| '|"-,-"| )\ | | , /(| | /( , ( / )| | (\ ( \ | ) ) (( )\ ( (| | ) ) ) , ) |/ ( ) \ / ) ) . ) |/ ( ( # ( ( , ) / ) ( * ( \#/| (`# ) `#/| |`#/ ( '( \#/ .-"#'-. .-"#'-, .-"#'-. .-=#"-; `#/ .-"#'-. |"=,-"| |"-.-"|) 1"-.-"| |"-.-"| ,-"#"-. |"-.-"| | ! | | | | | | ! |"-.-"| | | | |._,| | | |._,| a | | | | | | | | | | | p | | | | | | | | | | | x | | '-._,-' '-._,-' '-._,-' '-._,-' '-._,-" '-._,-'
- tx a55e7587bb34a56ae1113b0848506ea2fcf0c0e1af8c241e76677eb2bcb727eb (2016-04-27) via cryptograffiti.infoThe image is also reproduced a bit later at tx 959a19729ca02b1e06e600a331d7f4603669a7eaaa20b5cfb9f3528e3005a8f2, block 410357 www.blockchain.com/explorer/blocks/btc/410357 (2016-05-05). This second one includes the lyrics:
/y _, _ _ ,_ o888P Y8o8Y Y888o. d88888 88888 88888b ,8888888b_ _d88888b_ _d8888888, 888888888888888888888888888888888 888888888888888888888888888888888 Y8888P"Y888P"Y888P-Y888P"Y88888' Y888 '8' Y8P '8' 888Y '8o V o8' ` `
translation;Denk niet wit, denk niet zwart.
Denk niet zwart-wit
Maar alleen aan de kleur van je hart.of the 1984 song "Zwart Wit" (Black and white) by Dutch artist Frank Boeijen, sample performance by the artist:Don't think white, don't think black.
Don't think black and white
But only by the color of your heart. - tx 15fb36eb159d2bbc78a4a4dffc29d166e662a020f42211c176648015102cbf77, block 410366 (2016-05-05) via cryptograffiti.info has a cute "ASCII art poem" if you will:57bc317de1d9a1724b751a008951f76c79c0b787d47cb7561598cc62994237ab has a related one.
#################### Transhumanism and### singularity are lies and tricks. Don't### let them brainwash U and become enslaved# to Mr. Computer##### It's not intelligent #################### The Angels Trumpet## lures to takes away# your free will###### You loose emotions,# CREATIVITY, sanity## and true INNOVATION# You have been warned #################### Humans are not tools to abuse and discard They have never been and they'll never be #################### Love & cherish life# Don't give up ur <3! #################### Pray for the Victims Send them love###### Heal Mr.Computer too ####################
- tx e10c958e199daf71ab31342d40e188380fe84f07abee6a11d02c274d5431902a (2016-05-26) via cryptograffiti.info ASCII typeface spelling "CrimsonHexagon"The URL redirect is dead as of January 2024. Possible meaning: en.wikipedia.org/wiki/Crimson_Hexagon
_________ .__ ___ ___ \_ ___ \_______|__| _____ __________ ____ / | \ ____ ___ ________ ____ ____ ____ / \ \/\_ __ \ |/ \ / ___/ _ \ / \/ ~ \_/ __ \\ \/ /\__ \ / ___\ / _ \ / \ \ \____| | \/ | Y Y \\___ ( <_> ) | \ Y /\ ___/ > < / __ \_/ /_/ > <_> ) | \ \______ /|__| |__|__|_| /____ >____/|___| /\___|_ / \___ >__/\_ \(____ /\___ / \____/|___| / \/ \/ \/ \/ \/ \/ \/ \//_____/ \/ http://smarturl.it/spacetransient
Figure 8. I Love You Forever. tx ddc39a3da0ee6f0651bdf0be7119b4db2612b19416e9128091b1f29cdfe2aa0d (2016-06-20) via cryptograffiti.info. Busts of a man and a woman looking forward............................................................ ....................................... ........................................................?$OOZZOZ:. ................................. ......................................................?8I~,....,,=,................................. .... .................................................8~~~:::,,,,,~=................................ ~~::,.................................................==~~~:,,,,:,:I=............................... ::~~~::,,............................................:=====$8D+:~:~$7+ ............................. ,,,:::~~~::,... .....................................:IDD8DI$Z7$?=?$7+.............................. ,,,,,,,,::~~::,,....................................8?$Z$N:++?+=~~~~?~.............................. ,,,,,,,,,,,,::~~::,,.. .............................. =+D=,:=7+~:::=~=~............................. ,,,,,,,,,,,,.,,,:::::,,...............................+?7OIO8ZZ?~~+7+~,............................. ,,,,,,,,,,,.,,.,..,,:::::,,.. ........................?$NDD$ZODD=+?II,.............................. ,,,,,,,,,,,,,,,.,,....,,,::::,,... ..................,+8N$I$IZZOI$7I+O.............................. ,,,,,,,,,,,,,,.,,........,,,::::,,....................$8DD8O7?78OZ$I+,.............................. ,,,,,,,,,,,.,.,..............,,::::,,................ .D88ZZOZOOO$I+~+.............................. ,,,,,.,,,,,.,..............................,............888D8O8Z?+==~:.............................: ,,,,,,,,,,,,.,.............................,..............?$OI?+++=+....$+.....................::::: ...........,,,.................... .......................??+??++??..,.D8O$Z?..............,:::::::: ...........,,,...........................................IM7I??II+..,.ND8D88ZZ$Z$7......:::::::::::: ,,,,........................... ......................?7,D77$77I?7O,.DDND8888888.....:::::::::::::~: ,,,,,... ...................... ..................~ZOZ8.DN7?++Z?+IM=NNNDD88NDDN..,.....:::::,:~~:,,, ,,,,,,,..........................................O88NDDDNN+~=~==+NMMNNDDDNNNDD=,........,:~~,,,,,,,, ,,,,,,,.........................................$DDDDNNNNNI~~7~=MNNNNDNNNNNDD8,..,,......,,,,,,,,,,, ,,,,,:,... .. ..................................8DNNDDNNNNN::,?NNMNNNNNDDNNND7.:..,,......,,,,,,,,,, ,,::::,... .....................................DDDNNNDNNNN7,DNNNNNNNNNNNNDDD=,~,,,,,.......,,.,,,,, ::::::,........................................,DNNNNNNNNNNNDMNNNNNNNNNNNNNND,,,.,,,,.......,,,,,,,, ::::::,........................ ......... .....,NNNNNNNNMNNDMMMMNNNNNNNNNNNMN,,,,,,,,,.....,,,,,,,,, ::::::,.....,..................................+NNNNNNMMMMDNMMNNNNNNNNNNNNNMMN~=,,,,,,.,.....,,,,,,, ,,,,,,,,..................... ................:~NNNNNNNDNMNNNNNNNNNNNNNNNNNMMMD?,,,,,,,.......,,,,,, .....,,,....,................ ................::NDDNNNNNNMNNNMNNNNNNNNNNMMMMMMMM::,::,,.....,,,,,,,, .....,,,.....................................,::~NNNNNNMMNNNMNMNMNMMMMMNNMNNNNMM~:::::,,,....,,,,,,, ~~~~~~=:..................................,::,:::=NNNNMMMDNMMMMMMMMMMMMMMMMMNNMM?~:::::,,,....,,,,,, ?+????I~..............................,:::::::~~~~DNNMMMMNMMMMMMMMMMMMMMMMMMMMMMM~~:::,,,,...,,,,,,, ???????:...........................,::::::::::~~~~?DMMMMMN8MMMMMMMMMMMMMMMMMMMMMM~=:~:~,,,....,,,,,, +++++++:...,.,,..,,,,..,,,......:::::::::::,:~~~~=~OMMNNMMMMNMMMMMMMMMMMMMMNMMMMMZ==~~:::,....,,,,,, +++++++:.,..................,:::::::::::,~~:,~~=~+~7MMNMMNNMMMMMMMMMMMMMMMMMMNMMMM?++~~~::,...,,,,,, ++++++=:.................,::::::::::,:~~:,,,.~~=~+=DMNNMNMNMMNMMMMMMMMMMMMMMMMMMMMO+=:=~~~:,..,,,,,, +===+==:.... .........:::::::::::,:=~:,,,,...:===+=DNNNMDMMMMMMMMMMMMMMMMMNNNMMMMMM7=+?=:~,::,,,,,,, ====+==:,:,,,,,,,,,:::~::::::::~=::,,,,,.....~~++???NNNNDMMMMMMMMMMMMMMMMMMMNMMMMMMMI?=:~~~:.,.,,,,, ====+===~::::::~::::::::::::~=::,,,,.........:~??77$NMNMNDNMMMMNMMMMMMMMMMMMNNNMMMMM$$I+,~:::::,,,,, =======~~::::~~~~:::::::~=~:,,,,,,,..........:~=++7ZNNNMNMMMMMMMMMMMMMMMMMMMNNMMMMMNNI~=,:,.....,,,, =======~::~~~~~~~~:::~=~:,,,,,,,...,.........=+~+?ZONNNMNMMMMMMMMMMMMMMMMMMMMMMMMMMMD~~,,:,,:,:,,,,, =====~~~~~~~~~~~~~==~:,,,,,,,,,,,...........,:~=+IZONNNMMMMMMMMMMMMMMMMMMMMMNMMMMMMMD~:~~::,..,,,,,, Dr. Bill Maurer Economic anthropologist
Code 3.ASCII art of Dr. Bill Maurer.tx 06d2528cfabf360c7a8f925d84207d47612cd0ac1ad2efd8aea9758263d9738b (2016-07-13) via cryptograffiti.info entitled:His university home page faculty.sites.uci.edu/wmmaurer/ describes himself as:Dr. Bill Maurer
Economic anthropologistHis Wikipedia page: en.wikipedia.org/wiki/Bill_Maurer.Professor Maurer is a cultural anthropologist and sociolegal scholar. His work explores the technological infrastructures and social relations of exchange and payment.
Figure 9. Photograph of Dr. Bill Maurer. Source. Off-chain reference image for the ASCII art taken from his university home page: web.archive.org/web/20231109222608/https://faculty.sites.uci.edu/wmmaurer/- tx e35a9a198b77ece71272b66f94f9329184c6e4ee48e9e768e54ee8caf5d471fb, block 425758 (2016-08-18) via cryptograffiti.info has a dark one:which reads:
killyour children setthemz free.il+ 6(\___/) 6( O_O ) 6 `---`% evlbunny here)to@ rule^you
Kill your children, set them free. 666. Evil bunny here to rule you.
- tx eede99ab9b50aa5871fcb4b1d0d1a22ac2fa94b08172b1fa677f0b200e96f84a blk 437669 (2016-11-06):
__ / __ / * `' \ \ / ._,.__, APPLE BAKE '16
____________________________________________________ | AA | | AAAAAA | | AAAAAAAA | | AAAAAAAAAAAA | | AAAAAA AAAAAA | | AAAAAA AAAAAA | | AAAAAA AAAAAA | | AAAAAA AAAAAA | | AAAAAA AAAAAA | | AAAAAA AAAAAA | | AAAAAAA AAAAAAA | | AAAAAAA AAAAAAA | | AAAAAAAA AAAAAAAA | | AAAAAAAA AAAAAAAA | | AAAAAAAA AAAAAAAA | | AAAAAAAA AAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA | | AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA | | AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | | AAAAAAAAA AAAAAAAAA | |____________________________________________________|
Code 4.Study Math and Computer Science at Augustana College.tx 9caaa9f8d0e170bf6d73a722e9bb2e7e0d37577476d485bd3eeac09866f26345, block 440620 (2016-11-26). Input script inscription.Contains ASCII art of a large letter A. Has some custom encoding we didn't have the time to investigate which makes it deformed in our dumps, so we fixed it manually. The associated message reads:and so we understand that the ASCII art is formatted to look like the font of the logo of that university from Illinois.!Study Math and Computer Science at Augustana College!
Figure 10. "Augie A". Source. Off-chain reference image for the inscribed Code 4. "Study Math and Computer Science at Augustana College" typeface logo taken from the Augustana College website.Data Insertion in Bitcoin's Blockchain by Andrew Sward, Vecna OP_0 and Forrest Stonedahl is a paper published by some people of the university, presumably the culprits. This was brought to our attention via: twitter.com/ottosch_/status/1735297943563837726.See also: Figure "Augustana College Old-Main.jpg".- tx 12fba831eb6de8eb944e80e42c78d29cf05a833831a335a5711a4b61cf90802e (2018-04-06)Found by Messages from the mines.
Grishchuk Roman_____ Pavlovich___________ ________AND_________ Gres Anna Leonidovna Married 01/04/2015__ ==================== =====++++==++++===== ====++===++===++==== ===++====++====++=== ===++==========++=== ====++========++==== =====++======++===== ======++====++====== =======++==++======= ========++++======== =========++=========
- tx fd739c26276ea81fea8210939d527fccd7c9622f93aa17d18ee0bd5321387fde, block 517406 (2018-04-09) contains the first line of an ad from American stockbroker company TD Ameritrade. It is encoded one line per transaction with OP_RETURN, but the ordering is completely scrambled. A link is given: TDAmeritrade.com/Blockchain but it is 404 as of January 2024 of course, companies can't keep their pages up for more than 3 seconds, but there is an archive which decodes the indented picture for us, including the corresponding tx hashes for each line web.archive.org/web/20180902001329/https://www.tdameritrade.com/landing-pages/offer/blockchain/index.html?cid=TVTDACDDRTVJ64, here is a copy from the website because we were lazy to double check each line:
.............See the full picture at TDAmeritrade.com/Blockchain................ ................................................................................ ................................................................................ ................................................................................ .......................................................................^V^...... ........XXX......................................................^V^............ .......XXXXX.................................................................... ........XXX=====================................................................ ........| | ....................\\.............................................. ........| | .......................\\=========================.................. ........| | ..................................................\\................ ........| | ...................................................\\==========..... ........| | ...............................................................\\... ........| | ................................................................||.. ........| |.................................................................||.. ........| | XXXXXXXXXXXXXXX ................................................||.. ........| | XXXXXXXXXXXXXXX ................................................||.. ........| | X| .........\XX ....@ ..................* ..@ ..........@ ......||.. ........| | XXX| @ XXX\ XX @ @ @/@@@ @@ @/@ @ @@@ @/@ @@ @@@ .@@ ..||.. ........| | XXX| @ XXXX| XX @@@@@ @ @ @ @ / @ @ @ @ @ @ @ @ @ / ..||.. ........| | XXX| @ XXX/ XX @@ @@ @ @ @ @@@ @ @ @, @ @@ @@@ @@@ ||.. ........| | XXX| @ /XX ................................................||.. ........| | XXXXXXXXXXXXXXX ................................................||.. ........| | XXXXXXXXXXXXXXX ................................................||.. ........| | ................................................................||.. ........| | ................................................................||.. ........| | ................................................................||.. ........| | ................................................................||.. ........| | ................................................................||.. ........| | ................................................................||.. ........| |===================== ...........................................||.. ........| |.....................\\========== ...............................||.. ........| |.................................\\==============================//.. ........| |..................................................................... ........| |.....................................((((())))....................... ........| |...................................((((((())))).(((())))............. ........___..................................(((((((())))))(((()))))............ ......./___)................................((((((((()))))((((())))))).......... ....../ | |..................................(((((((((((())))))))))))).......... _____ ..| ( )................................................................... ........| ( )................................................................... | ( )..............(().(().............................................. _____\__| ( )............((((())))))............................................ ........| |.............((((((())))))).......................................... ........| |..................................................................... ........| |..................................................................... ....MMMM| |MMMMM................................................................ MMMMMMMM| |MMMMMMM.............................................................. MMMMMMMM| |MMMMMMMMMMMM...................................$..................... MMMMMMMM| |MMMMMMMMMMMMMMMM............................$$$$$$$.................. MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMM....................$$$$$$$$$$$$$$$............. MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMM............$$$$$$$$$$$$$$$$$$$$$$$.......... MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMM......$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$.... MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$ MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$ MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$ MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$$$$$$$$$$$$$$$$$$$ MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$$$$$$$$$$$$$$$ MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$$$$$$$$$$$$ MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$$$$$$$$$ MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$$$$ MMMMMMMM| |MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMM$$$$$$$ \\\\\\\\| |\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\ \\\\\\\\| |\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\ \\\\\\\\\ /\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\ \\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\ \\\\\ TD Ameritrade, Inc., member FINRA/SIPC. copyright 2018 TD Ameritrade \\\\\ \\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
- tx eda919b0a61b91c1fb030e6af314dfe5aaa6198416bfdaf8599d7f1a80c5d614, block 526446 (2018-06-07) starts an ASCII art spread across several transactions on different lines. Lines are completely scrambled, so either there is an index somewhere, or it was meant as a puzzle. This is the best we've managed to unscramble so far:At firs we thought it was some kind of tribute to the Cannes Film Festival, but given the string "Titanium" and the fact that all people mentioned on another section of the art work for advertisement companies, we understand that it is instead almost certainly about the "Cannes Lions International Festival of Creativity", previously "International Advertising Festival", which has a "titanium" prize category, e.g. as mentioned at: www.thedrum.com/news/2018/06/22/cannes-lions-winners-titanium-glass-grand-prix-good-and-more:
................................................................................ ..............................@(..@@@@@@%@@,.@@@@@@@............................ ........................@@@@..@@@@@(..@@@@@@@(.@@@@@@..@@@@@@@.@@@@..@.......... ......................@.@@@@..,..........@@@@@@...@@@#..@@@@@@@..@@@.@@@........ ....................@@@.@@@@..@....../......@@@@&..@@@..@@@@@@@@.@@@@.@@@....... ...................@@@..@@@...@..&@..@@........@@@%@@@..@@@@@@@@..@@@@@@@@...... ...................@@..@@@..../&.@@@@@@@........@@@@@@..@@@@@@@..,@@@@@@@....... ..................@@..@@@@....@..@.@@.@@@.......@@@@@@.@@@@@@@...@@@@@@@........ ..................@@..@@@@...@........@@@@......@@@@@@@@@@@@@..@@@@@@@@......... ...................@@@#.@@@@.,...................@@@@@@@@@@@@@@@@@@@@........... ....................@@@@.@@@@.@@............@.@@@&.....@@@@@@@@@@@@@............ .....................@@@..@@@@.@@@........@.@@@.@@@@@@@@@,..@@@@@@@@............ .....................@@@@...@@..@@@......@@@.@@@@@..@@@@@@@@..@@@@@............. .....................#@@@@@..@@..@@@@@@@@@@@.@@@@@@@..@@@@@@@.(@@@.............. ......................@@@@@@@@@...@@@@@@@@..@@@@@@@@@..@@@@@..@@@............... ........................@@@@@@@@@........@@@@@@@@@@@..@@@@..@@.................. ...........................@......%@@@@@@@@@@@@@@@@@@@@@@@@@.................... ...............................@@@@@@@@@@@@@@@@@@@@@@@@@........................ ..............................@@@@@@@@@@@@@@@@@......@@@........................ ..............................@@@@.....@@@@@@................................... .............................@......@@@@@@................#@@@@@@@@@@@.......... ..................................@@@@@@...............@@@@@@@.................. ................................@@@@@................@@@@@@@.................... .............................@@@@@.................@@@@@@@...................... ...........................@@@@@.................@@@@@@@........................ ........................*@@@@..............,@@@@@@@@@@@......................... ......................@@@@..........@@@@@@@@@@@@@@@@............................ .........@@@@.....@@@@@........*@@@@@@@@@@@@(................................... ........@@@@@@@@@@@.........@@@@@@@@/........................................... ......@..@@@....@@@.......@@@@@@................................................ .....@@@@@.@@#..........@@@@@................................................... ......@@@@@@@@@@@@@@@@@@@@...................................................... ...................................................................===========/. .........................................................==========..........//. ................................................=========..................../.. .........................................=======...........//XX...XXXXXXX...//.. ...................................======.........XX..XXXXXXXXX.XXX........./... .........................=========........XXX....XXX..XXXX.......XXXXXXXXX..\... ...............==========............XXX.XXXXX...XXX..XXXXXXXXX....XXXXXXX..\\.. \=============/..............XXXX....XXX.XXXXXX..XXX..XXX.......XXXX..XXXX...\\. \\..................XXXX.....XXXXXX..XXX.XXX.XXXXXXX..XXX../XXX..XXXXXXX.....\\. .\......XXXXXX......XXXXX....XXX.XXX.XXX.XXX...XXXXX..XXXXXXX................//. .\\...XXX...XXX....XXXXXXX...XXX..XXXXXX.XXX....\XXX....====================/... .\\..XXX..........XXX..XXX...XXX....XXXX.XX=....=======/........................ ../..XXX..........XXXXXXXXX..XXX............===/..######...###...###..####...... .//..XXX....XXX..XXX.....XXX.X......======//......#...##.###.###..##.##..##..... .//...XXXXXXXX..XXX.........======//................###..##...##..##..####...... ./.................=======//......................###....###.###..##.##..##..... /================//..........T.I.T.A.N.I.U.M......######...###....##..####...... ................................................................................ ..................Duncan.Marshall-Founding.Partner-Droga5-USA................... ..................Gail.Heimann-President-Weber.Shandwick-USA.................... ..............Susan.Bonds-Co-Founder.&.CEO-42.Entertainment-GLOBAL.............. .............James.McGrath-Creative.Chairman-Clemenger.BBDO-AUSTRALIA........... ............Fred.Raillard-Founder,.Chief.Creative.Officer-FF-GLOBAL............. ...........Eugene.Cheong-Chief.Creative.Officer-Ogilvy.&.Mather-APAC............ ..........Colleen.DeCourcy-Chief.Creative.Officer-Wieden+Kennedy-GLOBAL......... .......Caitlin.Ryan-Regional.Creative.Director-Facebook.and.Instagram-EMEA...... .......PJ.Pereira-Creative.Chairman.&.Co-Founder-Pereira.O'Dell-GLOBAL.......... .Jason.Xenopolous-Global.Chief.Vision.Officer.&.Chief.Creative.Officer-VML-EMEA.
The part with the at signs '@' which we believe represents the lion is the hardest one and we've perhaps gotten some lines wrong, corrections are welcome.The highly coveted Titanium Lions - created to honor marketing work that doesn't fit neatly into traditional categories
Figure 11. Cannes Lions logo. Source. Off-chain, for ASCII art reference. `...:. `''''';'; '+'''+'''' `'''++++'''' ;'++++';;'++, '+++++';;;''+, '+++++;;;;;++; '++++'';;;;;+': ::::::,,,,,,,,...`+'''';;;'';;;;;` ````````````` ::::::::::::::::::';'''';+++';;';:::::::::::::,,,, :::::::::::::::::::''';;''+'';;';::::::::::::::::: :::::::::::::::::::;''++'''';;;''::::::::::::::::: :::::::::::::::::::;+++++';'''''+;::::::::::::;::: :::::::::::::::::::::;'+'''''++'';#';::::::::::::: ::::::::::::::::::'+++''''''+''++'+'+;:::::::::::: :::::;:::::::::::'+++++''++++''++'#++''::::::::::: ;;;;::::::::::::'+###++#'+++'++++'#+#++'';:::::::: ;::;;;;;:::::::'++++++++#+++++++++#+++++++';:::::: ;;;::::;;;:;;;;++++'''''+####+++++##;++++++';:;::: :::;;;;;;;::::+##';''''''###+##++##+;++++++++':;:: :::;;;;::::::;+#+';''''''###++###+#+;###+++++''::: :::::::::::::#+#'''';''''+###+++####;##++++++++':; ;;;;;;:::::;:++++''++'''+####+++++##;#+#++++++++': ;;;;:;:::::::#++'#++++##++#++++++++#'###+++####++; ::::::;;;;;;;+++''''++'+++@+++++++'####+#++#+++++; ;;;;;;;;;;;;;;+#';'''''+'+##'+++++'+#####+++++#++; ;;;;;;::;:::;:'++'''+''+++##++'+''+#########+++++: ;;;;;;;;;;;;;''++'++'''++##+'+##++#+##+#+++##++++; ;;;;;;;;;;;'''''#++''''++##+###'#######+####++++;; ;;;;;;;;;;;;''''+#++'+++###'#+;'##+####+++#+++++;; ;;;;;;::;;'''''+'+##++++###'#';###+##+####++++++;; ;;;;;;'++'''''++++#++++####'+;+##+###++####++++;;; ;;;;:+++''''++++++#####@###'+;######+#++###++++;;; ;;;';;#+'''+++++++########+'++######+++++++++++;;; ;;;::;'+'+++++++++########''++##+##+++++###++++;;; ;;:+;''+++++++++++#+#####+''#+#+###+++#####+++';;; ;'';;+''+++++++++++######'''+######+++++###+++;;;; ;';;'''+#+++++++++######+'';#++############++#:;;; ;'';''+'++##++++++++####+'''###@########++#++#;;;; ;''''''+@++++#++++++####''+'##############++#;;;;; ;''''''''++++++++++++###''+'##############+##;;;;; ;'''''''''++++++++++++##+'''##############+#+;;;;; ;;;;''''''+###+++####+######################;:;;;; ;;;;+''''''+##############+#################;:;;;;
Code 5. . 2017-05-27 via cryptograffiti.info. A low resolution man and a woman hugging looking forward, signed "B&E April 9". The image /s repeated at: tx 47fafaa96c24d3f204658fb4bec34ab6f18df138084e04535ea60cce8c4e4857 without signature.- tx 79947c26f8abc8d5c2a9b5442005a5426f35f436119b3092f59e6fe3fad80df1, block 530614 (2018-07-05) has this lolcat:
lolcat test |\---/| | o_o | \_^_/0
- tx f8102999c0aaf7681deec383eb8e7946f093e94a116a21e367e9ed6b7c32d1fb (2018-08-23) contains the logo of the GrrCon, an annual cybersecurity conference with message:The actual code appears to be:
Your free GrrCon ticket
a reference to OP_RETURN. It is steganographically encoded diagonally across the skull's eyes. Ciro Santilli only saw this after grepping:OPRETURNISMYFRIEND
which made all nongrep @ data/out/0538.txt
@
signs stand out due to the terminal's syntax highligh. This image was uploaded one line per transaction with a few interruptions that we removed manually, and there were was a previous partial attempt a bit before: at tx f8102999c0aaf7681deec383eb8e7946f093e94a116a21e367e9ed6b7c32d1fb so either a failure, or maybe it was intentional to obfuscate things a bit.@@@@@@@@@@@@@@@@@@@@@@@@YOUR@FREE@GRRCON@TICKET@CODE@@@@@@@@@@@@@@@@@@@@@@@@@@@ @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@, *@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@ @@@@@@@@@@@@@@@@@@@@@@@@@@% @@@@@@@@@@@@@@@@@@@@@@@@@@ @@@@@@@@@@@@@@@@@@@@@@ .@@@@@@@@@@@@@@@@@@@@@ @@@@@@@@@@@@@@@@@@@ *@@@@@@@@@@@@@@@@@@@, @@@@@@@@@@@@@@@@@@ @@@@@@@@@@@@@@@@ @@@@( %@@@@ @@@@@@@@@@@@@@@ @@@@@@@@@@@@@@ @@@@ @@@& @@@@@@@@@@@@@ @@@@@@@@@@@@ @@@ @@@@@@@@@@@@@,@. @@@ @@@@@@@@@@@ @@@@@@@@@@ %@@ .&@@@@@@&%@@@@@&&&@@@@@# @@/ /@@@@@@@@@ @@@@@@@@@ @@ @@@&@@O@@@@@@@@@@@@@@@@(@@@@& @@ @@@@@@@@ @@@@@@@@ @@. .@@@,%&@@P@@@@@(,*&*@@@@@@@@#(#.@ (@@ @@@@@@@ @@@@@@* @@ @@(@%@@@@@&R@@@@&@@@@@@@&@@@@@@/ @@@ @@ @@@@@@ @@@@@# @@ @@@@@@@@,,@%@E@%@@@@@@@@@@@%@@@@@.@@@@ @@ @@@@@ @@@@@ @@ @.@@@@@,@@@(@,T@@@@@@@@@@@@@@@@@@@@@@@@ @@ @@@@ @@@@ @@ @&@@@@@@/@#@(@&@U@@@@@@@@(@@@@@@., #@@@@@ @@ @@@ @@@* @@ @@@@&@@&@ #@@@R@.@@@@@.@@@@@@@%@@(@@@@@ @@ @@@ @@@ @@ /@@*@@ @@@/N/@,@@@@@@@@@ @@@@@@, @@ @@ @@@ @@ @@@@@ @@.@I@@,@@@@@@@@ @@@@&@@ @@ @@ @@/ @@ @@@, (#@/S@@@@@@.,@ **@@&,@ @@ @@ @@ @@ %(( @#@@@@M@@@@@&@ #./%&@@* @@ %@ @@ @@ #&&@ @@@@&@@Y@@@@@ &@,@@@.( @@ %@ @@, @@ @@@@@@ *(@@%@@@F&@. @@&%@@ @@ @@ @@@ @@ @#@%@/@ @@@*@@@R( @@@&@ @@ @@ @@@ @@ @@@@@@@@@%@@@%%@@@@@@@%%/I@ @@@@, @ @@ @@ @@@. @@ @@@@@@@*@&@@@@# @(@@@@@@@@E@@@@@@@& @@ @@@ @@@@ @@ @@@@&@@(@@@@@@.@# @@@ @@@@N@@@@,@( @@ @@@ @@@@@ @@ @@@*@@&@@*(@ @@@&@@&@@D@@@@& @@ @@@@ @@@@@. @@ @/@,@@@@@@@@@@@@@@% @@ @@@@@ @@@@@@ @@ @@@@@@@@@@@@@,@@@@ @@ %@@@@@ @@@@@@@, @@/ @&@@(@@@@ @@@@@@@@@ &@@ @@@@@@@ @@@@@@@@@ @@ #%@(,&,@@@@ @(& @/,@ @@ @@@@@@@@ @@@@@@@@@@ /@@ @@&@@@@@,* @@& @@@@@@ .@@. @@@@@@@@@ @@@@@@@@@@@@ @@@ @(@@@@@@ @@@ .@(@@, @@@ @@@@@@@@@@@ @@@@@@@@@@@@@@ &@@@ @@@# @@@@@@@@@@@@@ @@@@@@@@@@@@@@@@ @@@@@ @@@@@ @@@@@@@@@@@@@@@ @@@@@@@@@@@@@@@@@@# .@@@@@@@@@@@@@@@@@@@ @@@@@@@@@@@@@@@@@@ @@@@@@@@@@@@@@@@@@@@@@ @ , . @ @@@@@@@@@@@@@@@@@@@@@ @@@@@@@@@@@@@@@@@@@@@@@@@@ @ @ @# @ *, @ @@@@@@@@@@@@@@@@@@@@@@@@@ @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@& @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
Code 6.Your free GrrCon ticket.Without@
s to better highlight the code:YOUR FREE GRRCON TICKET CODE , * % . * , ( % & , . % .& &% &&& # / / & O ( & . . ,%& P (,*&* #(#. ( * ( % &R & & / # ,, % E % % . . , ( ,T & / # ( & U ( ., # * & & # R . . % ( / * /N/ , , . I , & / , (# /S ., ** &, %(( # M & #./%& * % #&& & Y & , .( % , *( % F& . &% # % / * R( & % %% %%/I , . * & # ( E & & ( . # N , ( * & *( & & D & . / , % , % , / & ( & #% (,&, (& /, / & ,* & . . ( . ( , & # # . , . # *, &
Figure 12. GrrCON logo. Off-chain ASCII art reference. .,:x, .. ..; 'll' .;c;,.. ...'...::;;':coc.'o0xxxO00Ox;l:,',l.,;,,;c :'x;.'':::c;,..::,;ddddl:;'. .':.'...,;:c,:,:.:''0kkk0000k'. .l,,:;;c: c'kcckOOkxdl:;:clokOOkkxdolc:,..;..,';';cc:;c:l.'..xkxxOO0Ox'...,:ldc:.''. ...c:xOKKKKKOxocodxOKKKK00Okddl::;'. ..;'''cl.'ldxxdlcolddddoll:,;;',,d:;'... .. cxOKXNNXXOxkxk0KKOOO00OOkxdolcc;,'. ,'..'ooOKKOkolk00000OkkkOkdl:'.c''..., :0XNNNNXO00KKKKK000kdk0OOOOOOxoc;,:'...;dKKXKKOxok0XXXXXKKXXKK0kxlccc'.,,' lOOXXNNXKKKKK0OkxdkOKOox00KXXNNXXKOdl',dKKKKKKK0kxxOXXNXX0OxlcllodkOkxc';;: cKO0XNNX0kddolccc::cldxxdOKXXXNNNNXOkxoNNNNNNNNNXK0Oxxkkxoc:;,,'...':x0Oc,,; .'0KKKXKOdlcc:::::::;;::cccclloxOKXNNNOxKWWWWNNNNKOxdoocc:::;;;,,'... .ckOl'; .dKXK0Kklcccc::::::::::;;;;;;,,,:ld0XNXXXWWWNNNKxolcc::::::;;;,,'... ;xOc 0KKO0klc:::::::::::::::;;;,,...,:coOXXXNWWWNXOdlllcccc::::;;;;,,,''..... ,kx; ,KXKKOdcc:::::;;;;::::;;;,''...',;:cxKNXWWWNXOxdoollcc:::::::::::clxkkdlc;..o, lXXKOolcc::::::;;;;;;;;;,'......,;:cd0NNWWWX0xddoolllcccccccccccokOOkxdol:. 'c 'KXklcc::::::cc::::;;:;;;;,',,',;;:lokXNWWWXOkddoollllooodoolcccoxk0KKkd:;...; kNxllooddxddooooollllllcc:,,,;;;;;cod0NWWWNKOxdooloxO0000Okdl:;oodxxdol:,'. ;d0kdOO0000KKKKK0OkxoooxkkkkkxxdddlloxkXWWWWN0kdxk0K000KKKK0Oxl::;;clc:;,,... .k0OOxO0KKKXNNXXXK0xlccxKXXKKK00OOOOOxkNWWWWWX000OO0KXXOkOOxkddl:....;;;,'.... ddklxodxkkO0000000KkoloO0KKKXXXKK00OkO0XWWWWWXK000KK00Okxxxdxxxoc,..'lolc::;,. xodlodllllodddddxOkl:,,dOxkkkkkxxddddO0NN0KWWWXK0OOkkxddoooodkkxl:;...:ddolc:; dllollooooooooodxocc:''cddllllllllloxxONNlcNWWNK0xdddoolllloxOxkxolc;:lccodxdl O0ddooolllllloooolc::,';cddolllloodddxKXNdk0NNNX0kxddoolllooxOO0KK0kooc:::ldxo NNNdddlllllllodolllccc::cldollllllodxO0K0dxxk0XNX0OkxxddooodxxkOOOkxolcccooooo NNNxxxdooooodddk0K0kxkkOOxddoloooodxk00OxdxxxxxOXX00OkkxxdddxdxxxxkkkOkxoc::cc NXKkxxkxdddddoodxkO0KKOkkdoodddoodxkOkkxxxxxxxxxxOK0000Okkxxxk00KK0Okxxxoc:;;, XKXKxxkkxxxddddddxxkOOxddoooododdxkOOdxddddddoooddddk0K00OkxxkkkkOOOkkxdlc;,'. KXXW0OkOkk000OOOOOOOkkOkxxxOkkxxxkkOdoooooolooolooodxk0K000OOkkkxxxxdollc:;,,' KXXWWX0O0OkOkOOO0O000OO00OOkOOkkOOOdooolooooddooooodxdxKKKK000OOkxddoollllccco KXXWWWNK0KOOkxxxkOOOOOkxddoodxOO0OdddddddoddoddoddodxodXNNNXKK000OOkxxdddxxkKX KXWWWWWWNKKOkkxxxxxxxxxxdddxxOO0XXdlloodolooddodldooxox0XNNWNNNNXXXXKKKKXXXXXK XWWWWWWWWWXKOkxdoooooooooodxO0XWWWOloodolddddololllloOXWNNNNNNNNNNNNNNWWXXXXKK WWWWWWWWWWWWX0Okkxxxxddddxk0KXWWWWXdcooocllllll::ccoXWWWWNNNNNWWWWNNNNNNXXKKKK WWWWWWWWWWWWWWXKKK000OOO0KXNWWWWWWNOlllollocl:lllkXNWWWWWNNNNNNNNNNNNXXXKKKKKK WWWWWWWWWWWWWWWWWWWWWWWWWWWWWWNWWWNXloccxdxkoldOXNWWWWWWWWNNNWNNNNNNNNXXXXXXXX
Code 7.ASCII art of two low resolution faces. tx 75b431e0a8c4617ca8adefe593ba66aa30907742b6dc8772761bfe7edabd74b4 (2018-12-30). Input script inscription. Two low resolution faceskkkkkkkkkkkkkOOOO0000OOOkdc:,''... ............';oooodxdx0K0OKKXXXXKKNNNWWWNW kkkOOOOOOOkkOOOO000K00Oxc;'.''... ...............':lodOxxKK000KKKKKKXNNWWWWWW 0kkkkOOOK000000KKKKKKOl;,'...,'.. '. ..........,ckKdx000000KKKKXNNWWNNWWW OOOOOOOOXNXXXXX0kkOxd:,'........ .,. ...........cddk000000KXXNWWWWWWWWWW XXKXXXXXKKKKKKKKKXKx;'.... .... .:. ............. .;oOXNNNNWWWWWMWWMMMWMMM OOOOOOOOOOOOOO0OOOx;.. . ....':.. ...... ... . .,OXXXXXXXXXWWWNWWWWWWW xxxxxkkkkkkkkOOkkx:.. .';:c:,;;...'... .. .:k0000000XNNNNWWWWWWW xxxxxkkkkkOkkkO0Kd.. .,:odxxkkxkOxoc,. .o00000KXNNNNNWWNWWWW xkxkkkkOOOOO00KOkc. 'clldxxxkkOO000Okxl:'. ,kO000KNNNNNWWWNWWWW xkxxkkkO00KKK00Ok;. ,loddxxxkOO0000OOkxxdl;. .d00000XNNNNNNNNWWWW kkkkOO0KKK00OOOOk'. .,:cldxxxkkkOOOOOOkxdlc:,.. o00OO00KXXXXXNNNWNN 00KKXXXKKKKKKKKKO; .;cc,'.'cldxxkxdoc,',cll:,;. .'OKKKXXXXNWWWWWWWMMM NNNNNNWWWWWWWWWWNk . ':c:cl;cdoclxkdlooo;ccclcc;. ..x00KKKKXXXKKKKKXXKXX kkkkkkkkxxkkkddooo:. .. 'clllooodolcdxoodddddooolc;. ...O00000000000OO000OOO xxxxxxxxddkkkxdolll:'. .clooddxxolldxoodxkxxxdool;. ..'.xxkkkkkkkOOOOOOOOOOO oooooodddodddol:;;;:.. ,loddxxxllldxlloxxkkxddoc;. ..lXXNNNNNWWWWWWWWWWWWW oooooddddddxxxxdddxd.. ;lodxddccokxlolxddxxdoc:. ..lONWWWWWWWWWWWWWWWWWW 00000KKKKXXXXXXXXXXXl; . .;colloollododdddllolc:, .....:kNWWWWWWWWWWWWWWW XXNNNNNNNNWWWWWWNNNXx,. .;collcclodolllooolcc, ... .:xOOkkkkkxxxddd NNNNNNNXXXXKKKKKOkx'.. . .':lolccccclodddol:' .:lccccccccc:: ooooooodddddddoc;'... .... .;loooddddxddlc;. ..,:loool:::c::::::: lllllllllloll:,,'....... . .:odddxdol;'. ...'coooooooooo:::::::::: ccccccccclcc;'''''.. .',;;'. .';coolollod::::::;;; :::ccc::;;,..... .',:cllo:::;;;;; :::,'.'... ..,c:;;;;;; ;...... ..';;;;; ccc. .,,,, cc. .',, ., .,,
- tx 1f23df23751bdd6c2e3ac138ed0de9d9a6b749c50d7da09d2c0a6d63ab237fe8 block 591520 (2019-08-24) contains a cute ASCII art poem split one line per transaction as suggested by the poem itself:
_______________________________________ | An immutable poem | | Unchanging over time, forever | | Written in transactions flowing | | | | Unbroken blocks for a Rose | | That I found in September | | Freedom gives this simple prose | | For all our time together | | | | Thank you for being you |O | Like this poem, it is forever |, | After all these years true | | I love our time together |
- tx b8e80f2bd1eac8c6db4dfb8b6cc9c8eb71133cbc1a0d32e6952c1a2818eecc8f, block 652005 (2020-10-09) contains the obituary for Yang Yiping, a Christian Chinese lady who lived in Germany:
.-==-. | | | | .-=====' '=====-. | Yang, Yiping | *-====-. .-====-* | | | 杨 | | | | 一 | | 平 | | | | | `-==-´ *~~~~~~~~~~~~~~~~~~* Yang, Yiping 杨 一平 .~~~~~~~~~~~~~~~~~~. ✰ 1957-07-19 ✞ 2020-10-08 '~~~~~~~~~~~~~~~~~~' Wir vermissen dich! 杨一平, 我们思念你 ヾ( ̄▽ ̄) 杨一平与 耶稣在一起 //yang.yiping.de/btc
Translations:- Wir vermissen dich: We miss you
- 杨一平: Yang Yiping
- 我们思念你: We miss you
- 杨一平与耶稣在一起: Yang Yiping is with Jesus
The link yang.yiping.de/btc is dead with no archives, but the toplevel yang.yiping.de survives as of 2024 and contais an obituary in a WordPress website. The Bitcoin message is acknowledged on the website at:The website is also mirrored at yiping.de. The navigation is a bit confusing, but yang.yiping.de/?cat=10 contains a blog with many entries, presumably by her husbandarchiviert auf der BTC Blockchain TX b8e80f2bd1eac8c6db4dfb8b6cc9c8eb71133cbc1a0d32e6952c1a2818eecc8f
- the first post is from slightly before her death on 2020-09-01 and documents their 2019 trip to San Francisco apparently to visit family. She could be a COVID-19 casualty.
- yang.yiping.de/?p=367 gives transliterated names of her three children: Kaibin, Ella and Martin
- yang.yiping.de/?p=638 has some mentions of work colleagues, but not enough to easily identify where she worked
Figure 13. Off-chain image of Yang Yiping. Source.A previous failed upload is present at: tx b4ba91b4892ff85a5eb18b85bc1fd744d9418b2a71f1dc130447893b9e1cab60, block 651974 (2020-10-09)The upload is done as P2PKH (20 bytes at a time) and is meant to show with newlines after each ouptut, BitLen style. It is also further broken down on our upload by the presence of UTF-8 characters. brando2131 helped decoded this message on Reddit, after Ciro Santilli reached out for help after seeing his work on the Code 9. "ZN inscription". - tx 0d034d6dc3cfa8c8ebb1df202ada251bdf890f9dd5f0c4dffbe185b8cc5c999d, block 669986 (2021-02-10) a teddy bear, also visible e.g. at www.asciiart.eu/toys/teddy-bears? "xoxo" means hugs and kisses. Maybe this was in preparation for St. Valentine's day a bit later on February 14th?
___ {~._.~} ( Y ) ()~*~() (_)-(_) xoxo, S
- tx 7076d9a40b44e92d8b96f9f5f1cb258619356d0789fe5bcf5197e2eaeb2b9eab block 693550 (2021-07-31) contains what could be an obituary for a bird:and tx b478c2a3566fa644ccb3c9da567f39c9030e337537610c9ff5c5c885ea6109b8 block 693776 appears to follow up on it:
YOU ARE _ |o}= | ( / /) /_// _/_// \/_' __LL SO FAT
Cute._ _ /and\/so \ | (o><-) | \//\ /\\ V_/ \_V `\ / ' loved Chris<3
- tx 5c4f060e6166a530d891cafd0e9df42441d29b1ed9cff71a1652201b8d50bd72 (2021-10-27) TODO what does it represent? It seems so familiar... Decoded from our dumps with
fold -w80 -s
. It is encoded as a sequence of 43 OP_RETURN output scripts each containing 80 payload bytes each:d, ,do' ;d; :NNk;. .OWWk. .:OWK, '0MMWO:. ... .xWMMWd. .. .l0WMMk. dMMMMW0l. .,coxO0Kd..oWMMMMNl .xK0kdl:,. .oKWMMMWl ;KMMMMMWKo. .lXMMMMMX; :XMMMMMMX; :NMMMMWKc. 'dXMMMMMM0' oWMMMMMMMXd'.'dXMMMNc ,0MMMMMMO. lWMMWKl..,xNMMMMMMMNc .dNMMMMMMMMNx,..oXMMK; :XMMMMK; :XMWKc..;kNMMMMMMMMNl. ;kNMMMMMMMMNk, 'kWM0' lNMMX: ,KMNd..:OWMMMMMMMMNx, . '..,xNMMMMMMMMNd..oNMk..dNXo .OMXc .xNMMMMMMMMXd'.'' .'. ,ko..kXo'.,xXMMMMMMMWx..dWWd..;,..xWNl .OWMMMMMMMKo..,xNx..kO; .xNWo ,KMMXd,.'dXMMMMMMWl '0MNl oNMO..dWMMMMMWKl..;kNMMO..xMNx' cKMMN: :NMMMMNx,..xNMMMMMO. dMMX; :XMWl ,KMMMMMXo..:kNMMMMK, lWMMXc. .dNMMMNc '0MMMMMMNklOWMMMMMN: :NMM0dxKMMK, lWMMMMMNxoOWMMMMMWk. oWMMMWx. .kWMMMMMK:..oXMMMMMMMMMMMWNNNd .OMMMMMMMMk..kWNNWMMMMMMMMMMMKl..lXMMMMMWk. .;lx0XWMMNk,.'xNMMMMMWKd:,'.,' dMMMMMMMWl ',.',:dKWMMMMMNd..;OWMWNKkdl;. .coc,...,cokKKd..:KMMMNd. 'ldxd:. ,KMMMMMM0' .:dxdl' .dNMMW0; .okkoc;'..';coc. lNMMWXOxl:'..';, ,0MWo .',;::;. ;KMMMMK; ,::;,'. dWWk. ....':ldOKNWMMN: '0MMMMMMMMMNKkdc;. ;KX; ,xxdool;. lWMMNl .:loddkx, ;X0' .:lxOKNMMMMMMMMMMO.lWMMMMMMMMMMMMMMWXo. o0, .;loxkkx:. .OMMO. .:dxkkxo:. ;0c .kMMMMMMMMMMMMMMMMN:dXXXXXXXXXXXXXXXXXo .c' ,c;'....',,. dMMd .;:,'....,:' ':. .dXXXXXXXXXXXXXXXXXl................... dMMWNXXXNWK, lNNl ;XMWNXXXNWMd ...................xkkkkkkkkkkkkkkkOl..c; .xMMMMMMMMMN: cXXc :NMMMMMMMMMx. ;; .okkkkkkkkkkkkkkkkdWMMMMMMMMMMMMMMMNc ,K0' .kMMMMMMMMMN: :KK: :NMMMMMMMMMk. ,0O. oWMMMMMMMMMMMMMMMXWMMMMMMMMMMMMMNKo..xWWk. lNMMMMMMMMX; .... ;XMMMMMMMMNc 'OMWo .dKNWMMMMMMMMMMMMXNMMMMMMMNKOdl:'. cNMMWk. lNMMMMMMMNOddddddONMMMMMMMXc .OWMMK; .';cdk0XWMMMMMM00MNKOdl:'...;cl. '0MMMMWk. cXMMMMMMMWXKXNXKNMMMMMMMX: 'OWMMMMk. ,ol;'...,cox0XWx,;'...;cok0NWWd..xWMMMMMM0, ;0MMMMXd,...'..'cOWMMW0, ,0MMMMMMWd..kWMNKOxl:,...,..;dk0NWMMMMMWk..oWMMMMMMMMK: .xNMMWOl,.....:xXMMNx..cXMMMMMMMMNc '0MMMMMMMWXOx: .xWMMMMMMMMMO. lNMMMMX0XWMMNl cKMMMMWX00KNWMMM0: .xNMMNOxKMMMMX: ,0MMMMMMMMMWl '0MMMMMMMWO' cXMMMMX:.oWMMMx. .dNMMMMMMMMMMXd. lWMMMX; cNMMMMK: ,0MMMMMMMMk. :XMMMMMWk. lXMMMMMx..kMMMMd .c,.'dKWMMMMW0o'... cWMMMWd..kMMMMMK: 'OWMMMMM0' cXMMMNo..oNMMMMMK, cNMMMNc ;XXx;..,:cc:,..;xKc ;XMMMMX: ;XMMMMMXl..xNMMMK, :XWO; 'kWMMMMMNl '0MMMM0' oWMMWKxlc::coxKWMMx..kMMMMMO. oWMMMMMNx..:KW0, ,:..cKMMMMMMWd..xWMMMWo .OMMMMMMMMMMMMMMMMMK, cNMMMMWd..xWMMMMMW0:..:. .kWMMMMMMWx..dWMMMMK, lWMMMMMMMMMMMMMMMMMWd .OMMMMMNo..xWMMMMMMNd. :0WMMMMWd..oNMMMMWl '0MMMMMMMMMMMMMMMMMMMX; :XMMMMMNo..xWMMMMWk, .lKWMXl..xWMMMMMk. ,0WMMMMMMMMMMMMMMMMMNO, oWMMMMMNd..lXMWO:. .ld, ,OWMMMMMK; ...:kNMMMMMMMMMMMMMXx,..' .kMMMMMMWO, ,o:. '0MMMMMMNc 'O0l..,dXMMMMMMMMMXd'.,dXXc '0MMMMMMWO. .ckXWMWd..kWMMXd,.'dXMMMMMNx'.,xNMMMK; ;KMMWKx:. .:dl..dWMMMMMNx,.'xNWW0: .dNMMMMMMK; ;xo;. .cxOKNWMMMNd..:oc. :KMMMMWNKkd, .;lxOKXNk. :XNX0kdc,.
- tx 71d9187cbb7b00b4c516df218499bbc301996262cfafc4533fd7916af1fb6315, block 709632, (2021-11-14) starts a consecutive sequence of transactions that encodes the characters 'Z' and 'N', an ad for the Zenon Network blockchain. This is the very first taproot enabled block, foreshadowing the great inscription boom that taproot would lead to, notably in the form of ordinal ruleset inscriptions.This ASCII art had been previously noted by sroose and decoded by brando2131 on Reddit, and was brought to our attention by Bagfoot OP446 on twitter. Ciro Santilli had previously spotted the art, but failed to decode it. "ZENON NETWORK" is inscribed just after the art confiming the meaning of the characters, but it does not appear in our ASCII dumps presumably because the string it is too short and surrounded by non-ASCII.
,zzzzzzzzzzzzzzzzzzzzzzzz, .:1zzzzzzzzz. .:qqzzzzqqq, ,;1zzzzzqqq, ,;1zzzzzqqq, ,;qzzzzz1qq, ,zzzzzzzzzzzzzzzzzzzzzzzz, ,zzzzzq;. 1zzzz, ,zzzzzzzzq, 1zzzz, ,zzzzzzzzzz1: 1zzzz, ,zzzzq:1zzzzzq;. 1zzzz, ,zzzzq ,qzzzzzz1, 1zzzz, ,zzzzq .;qzzzzzq:1zzzz, ,zzzzq ,qzzzzzzzzzz, ,zzzzq .;qzzzzzzz,
Code 9.ZN inscription.Each line is encoded with OP_RETURN, is 38 bytes long, and starts and ends in 6 spaces, leading to 26 non-whitespace characters per line. The lines appear in scambled order and it is unclear if there is any logic in the ordering or if it was just meant as a little puzzle. But given the nearby "ZENON NETWORK" inscription, this decoding is overwhelmingly likely correct.The following lines also show up in our ASCII dump:They seem like Base64 encoded data due to the;4Fdzw1k=zzzzzzzzzzzzzzzz; ,vtv3f5aKY0jGQglP9a1AGw==. ;BynQtpeUyWTXKGTrGhdV2Q==; ;tVMd3L1CKM4wFmyxEEEUV2bY;
=
sign padding, but nothing human readable comes out of them, so their meaning remains currently unknown. - tx cbf7cfb6c074e35e82ea604e2de6c82d00c168d7d7a1205383f93a6f40ee8520 (2022-01-24) ASCII typeface ad for Keepcase, some kind of Bitcoin hardware wallet. Manually converted to horizontal form to not take up too much space here.A bit later we see another ad for the same company:
@@@@@@@@@@@@@@@@@@@V/@@@@@@@@@@@@@@@@@@@ @@> @ @. @, @' @; @^ @'' @: @> # @ ### ###* @ ########### @ ##########* @ /########### @ ###########* @ /######### @ ##########/ @ ###########/ \@@@@@@@@@@@@@@@@@@@ ####### @ ### ## @ ### @ ###. @ ### ##### @ ###/* @ ### *## @ ####, @ ####" @/// ##### ##### @ ########( @ ######### @ ######## @ ##########. @ ##< @ ####### ### @ *######### @ ####### KEEPCASE : THE ###( #### #### @ ### ###. @ ###\ @ #### @ #####/ @ ###\. @ ####### ##/ @ #### @ ###_ ORIGINAL HARDWARE ### ### ### ## @ ### ###\ @ ########## @ #########/ @ ###/ @ \#########* @ ### #* @ ######### @ ###########( WALLET CASE ### ## ## ### ### ### ## ### #### #### ##### ####* ######, @@>>
Figure 14. keepcase.jpg. tx 6ea24c417d60a1c5312ca8ec0ab44bbdba2d79d84ceffa4c9455e02f89831d7f (2022-01-24) contains a data URL for a JPEG image:/@@@@@@@@@@@@@@@@@@@data:image/jpeg;base64,<base64 image> \@@@@@@@@@@@@@@@@@@@
- tx 3c9216146bf1d9415ded8a1d03dd63fae8f0af2cbcaf68efaff4ad654a45b74d (2022-06-08) tiny face. The
--BEGIN TRIBUTE--
format is a call back to BitLen, but they just don't do ASCII art like the old days anymore:---BEGIN TRIBUTE--- ....!&&&&&&#####B!.: ...:GB5Y55555PG#&Y.. ...^B7^::::^^~7P#J.. ...:Y7??!^~7?J?JP!.. ...:7!!?7~7???7?J!.. ....^!^:~~7!^~77^:.. :....!7!7???7?J!..:. ::...:7Y?77?YYJ!:..: :::::.~?JJY5Y77?Y5^. ----END TRIBUTE--- B5
- tx 14e89fc01c367841f2d5c2786a3b051d67008be980694272530546a0452aeea9 (2022-07-05). ASCII typeface for:This seems to be aa Thai name, e.g. possibly www.linkedin.com/in/chokchai-thawatcharaporn-179398213/?originalSubdomain=th. And so we learn that Thai people are the coolest because their name can end in "-porn" which is awesome. The given name is:
Chockchai Chawatcharaporn
and the rest is just more of the same, just 10x longer. Manually converted to horizontal form to not take up too much space here.@ ###########* @ ### ###' @ ######## @ ### ###* @ #########* @ ### ###" @ /######### @ ########/ @ @ ###/* @ ### ### @ ### ###, @ ### ## @ ##/* @ ### ### @ ### *## @ ###. @ @ ##< @ ########## @ ### ###] @ ########( @ ##( @ ########### @ ####### ### @ ###, @ @ ###\. @ ### ###. @ ###\ ### @ ### ##. @ ##\ @ ### ###. @ ### ##/ @ ### @ @ \#########* @ ### ###/ @ #######/ @ ### ###\ @ ##########\ @ ### ###/ @ ### #* @ /########## @
Tip for ASCII art hunters:
grep -n -r ' ' . | sort
grep -n -r '@@@' . | sort
grep -n -r 'XXX' . | sort
grep -n -r '...' . | sort
NCBI taxonomy entry: www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=511145 This links to:
- genome: www.ncbi.nlm.nih.gov/genome/?term=txid511145 From there there are links to either:
- Download the FASTA: "Download sequences in FASTA format for genome, protein"For the genome, you get a compressed FASTA file with extension
.fna
calledGCF_000005845.2_ASM584v2_genomic.fna
that starts with:>NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG
- Interactively browse the sequence on the browser viewer: "Reference genome: Escherichia coli str. K-12 substr. MG1655" which eventually leads to: www.ncbi.nlm.nih.gov/nuccore/556503834?report=graphIf we zoom into the start, we hover over the very first gene/protein: the famous (just kidding) e. Coli K-12 MG1655 gene thrL, at position 190-255.The second one is the much more interesting e. Coli K-12 MG1655 gene thrA.
- Gene list, with a total of 4,629 as of 2021: www.ncbi.nlm.nih.gov/gene/?term=txid511145
A waste of time. Output in my source files pollutes git and prevents me from editing it in Vim. Just let me run the freacking code and render images as standalone PNGs which I can include from Markdown.
Although Ciro Santilli is a big fan of plaintext files and of Vim, not so for games. Games must be easy to understand since they are just a toy.
Tilesets to the rescue!