New articles - OurBigBook.com

Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".

We'll realize that a lot of data and IDs come from/match BioCyc quite closely.

reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
```
"abbrev" "id"
"n" "CCO-BAC-NUCLEOID"
"j" "CCO-CELL-PROJECTION"
"w" "CCO-CW-BAC-NEG"
"c" "CCO-CYTOSOL"
"e" "CCO-EXTRACELLULAR"
"m" "CCO-MEMBRANE"
"o" "CCO-OUTER-MEM"
"p" "CCO-PERI-BAC"
"l" "CCO-PILUS"
"i" "CCO-PM-BAC-NEG"
```
- CCO: "Celular COmpartment"
- BAC-NUCLEOID: nucleoid
- CELL-PROJECTION: cell projection
- CW-BAC-NEG: TODO confirm: cell wall (of a Gram-negative bacteria)
- CYTOSOL: cytosol
- EXTRACELLULAR: outside the cell
- MEMBRANE: cell membrane
- OUTER-MEM: bacterial outer membrane
- PERI-BAC: periplasm
- PILUS: pilus
- PM-BAC-NEG: TODO: plasma membrane, but that is the same as cell membrane no?
reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
```
"position" "direction" "id" "name"
148 "+" "PM00249" "thrLp"
```
corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
```
"aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
[91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
```
so we understand that:
- aaCount: amino acid count, how many of each of the 20 proteinogenic amino acid are there
- seq: full sequence, using the single letter abbreviation of the proteinogenic amino acids
- mw; molecular weight? The 11 components appear to be given at reconstruction/ecoli/flat/scripts/unifyBulkFiles.py:
  molecular_weight_keys = [ '23srRNA', '16srRNA', '5srRNA', 'tRNA', 'mRNA', 'miscRNA', 'protein', 'metabolite', 'water', 'DNA', 'RNA' # nonspecific RNA ]
  so they simply classify the weight? Presumably this exists for complexes that have multiple classes?
  - 23srRNA, 16srRNA, 5srRNA are the three structural RNAs present in the ribosome: 23S ribosomal RNA, 16S ribosomal RNA, 5S ribosomal RNA, all others are obvious:
  - tRNA
  - mRNA
  - protein. This is the seventh class, and this enzyme only contains mass in this class as expected.
  - metabolite
  - water
  - DNA
  - RNA: TODO rna vs miscRNA
- location: cell compartment where the protein is present, c defined at reconstruction/ecoli/flat/compartments.tsv as cytoplasm, as expected for something that will make an amino acid
reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
```
"halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
```
- halfLife: half-life
- mw: molecular weight, same as in reconstruction/ecoli/flat/proteins.tsv. This molecule only have weight in the mRNA class, as expected, as it just codes for a protein
- location: same as in reconstruction/ecoli/flat/proteins.tsv
- ntCount: nucleotide count for each of the ATGC
- microarray expression: presumably refers to DNA microarray for gene expression profiling, but what measure exactly?

reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:

>E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG

reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
```
"expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
```
- promoter_id: matches promoter id in reconstruction/ecoli/flat/promoters.tsv
- gene_id: matches id in reconstruction/ecoli/flat/genes.tsv
- id: matches exactly those used in BioCyc, which is quite nice, might be more or less standardized:
  - biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486
  - biocyc.org/ECOLI/NEW-IMAGE?type=OPERON&object=TU00178

reconstruction/ecoli/flat/genes.tsv

"length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"

reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
```
"id"                       "mw7.2" "location"
"HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
"L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
```
In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
- biocyc.org/compound?orgid=ECOLI&id=L-ASPARTATE-SEMIALDEHYDE: "L-aspartate 4-semialdehyde" has ID L-ASPARTATE-SEMIALDEHYDE
- biocyc.org/compound?orgid=ECOLI&id=HOMO-SER: "Homoserine" has ID HOMO-SER
so these are the compounds that we care about.

reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:

"reaction id" "stoichiometry" "is reversible" "catalyzed by"

"HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
  {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
  false
  ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]

"HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
  {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
  false
  ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]

catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.

reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
```
"process" "stoichiometry" "id" "dir"
"complexation"
  [
    {
      "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
      "coeff": 1,
      "type": "proteincomplex",
      "location": "c",
      "form": "mature"
    },
    {
      "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
      "coeff": -4,
      "type": "proteinmonomer",
      "location": "c",
      "form": "mature"
    }
  ]
"ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
1
```
The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
Fantastic literature summary! Can't find that in database form there however.

reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:

"name" "comments" "mw" "location" "reactionId" "id"
"aspartate kinase / homoserine dehydrogenase"
""
[0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
["c"]
"ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
"ASPKINIHOMOSERDEHYDROGI-CPLX"

reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.

reconstruction/ecoli/flat/tfIds.csv: transcription factors information:

"TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
"arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
"fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
"dksA" "EG10230"

 Read the full article

E. Coli strain by

Ciro Santilli 35  Updated 2025-01-10  +Created 1970-01-01

 View more

Reference strain: E. Coli K-12 MG1655.

 Read the full article

E. Coli K-12 MG1655 gene thrB by

Ciro Santilli 35  Updated 2025-01-10  +Created 1970-01-01

 View more

Immediately follows e. Coli K-12 MG1655 gene thrA,

Part of E. Coli K-12 MG1655 operon thrLABC.

 Read the full article

E. Coli K-12 MG1655 gene fnr by

Ciro Santilli 35  Updated 2025-01-10  +Created 1970-01-01

 View more

Transcription factor for E. Coli K-12 MG1655 operon thrLABC as shown at biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486.

 Read the full article

C6 Oxford physics course by

Ciro Santilli 35  Updated 2025-01-10  +Created 1970-01-01

 View more

Video 1.

A very honest review of my Oxford University master's degree (theoretical physics at keble college) by alicedoesphysics (2020)

Source. Basically all her courses are from the Mathematical Institute of the University of Oxford, and therefore show up at the Moodle of the Oxford Mathematics Institute of Oxford.

 Read the full article

Mycoplasma genitalium by

Ciro Santilli 35  Updated 2025-01-10  +Created 1970-01-01

 View more

www.lgcstandards-atcc.org/products/all/49896.aspx:

£355.00 in 2019
biosafety level: 2

Size: 300 x 600 nm

Reproduction time: www.quora.com/unanswered/How-long-do-Mycoplasma-bacteria-take-to-reproduce-under-optimal-conditions

Has one of the smallest genomes known, and JCVI made a minimized strain with 473 genes: JCVI-syn3.0.

The reason why genitalium has such a small genome is that parasites tend to have smaller DNAs. So it must be highlighted that genitalium can only survive in highly enriched environments, it can't even make its own amino acids, which it normally obtains fromthe host cells! And because it cannot do cellular respiration, it very likely replicates slower than say E. Coli. It's easy to be small in such scenarios!

Power, Sex, Suicide by Nick Lane (2006) section "How to lose the cell wall without dying" page 184 has some related mentions puts it well very:

One group, the Mycoplasma, comprises mostly parasites, many of which live inside other cells. Mycoplasma cells are tiny, with very small genomes. M. genitalium, discovered in 1981, has the smallest known genome of any bacterial cell, encoding fewer than  genes. Despite its simplicity, it ranks among the most common of sexually transmitted diseases, producing symptoms similar to Chlamydia infection. It is so small (less than a third of a micron in diameter, or an order of magnitude smaller than most bacteria) that it must normally be viewed under the electron microscope; and difﬁculties culturing it meant its signiﬁcance was not appreciated until the important advances in gene sequencing in the early 1990s. Like Rickettsia, Mycoplasma have lost virtually all the genes required for making nucleotides, amino acids, and so forth. Unlike Rickettsia, however, Mycoplasma have also lost all the genes for oxygen respiration, or indeed any other form of membrane respiration: they have no cytochromes, and so must rely on fermentation for energy.

Downsides mentioned at youtu.be/PSDd3oHj548?t=293:

too small to see on light microscope
difficult to genetically manipulate. TODO why?
less literature than E. Coli.

Data:

www.ncbi.nlm.nih.gov/bioproject/97 contains genome, genes, proteins.
www.genome.jp/kegg-bin/show_pathway?mge01100 all known pathways. TODO: numerical reaction coefficients? Which enzyimes mediate what? Appears to factor pathways across organisms, which is awesome.

 Read the full article

Lattice Microbes by

Ciro Santilli 35  Updated 2025-01-10  +Created 1970-01-01

 View more

GPU accelerated, simulates the Craig's minimized M. genitalium, JCVI-syn3A at a particle basis of some kind.

Lab head is the cutest-looking lady ever: chemistry.illinois.edu/zan, Zaida (Zan) Luthey-Schulten.

2022 paper: www.cell.com/cell/fulltext/S0092-8674(21)01488-4 Fundamental behaviors emerge from simulations of a living minimal cell by Thornburg et al. (2022) published on Cell
faculty.scs.illinois.edu/schulten/lm/ actual source code. No Version control and non-code drop release, openess and best practices haven't reached such far obscure reaches of academia yet. One day.
blogs.nvidia.com/blog/2022/01/20/living-cell-simulation/ Nvidia announcement. That's how they do business, it is quite interesting how they highlight this kind of research.
- catalog.ngc.nvidia.com/orgs/hpc/containers/lattice-microbes has a container

 Read the full article

M. mycoides strain by

Ciro Santilli 35  Updated 2025-01-10  +Created 1970-01-01

 Read the full article

M. mycoides JCVI strain by

Ciro Santilli 35  Updated 2025-01-10  +Created 1970-01-01

 View more

www.newyorker.com/magazine/2022/03/07/a-journey-to-the-center-of-our-cells A Journey to the Center of Our Cells (2022) by James Somers comments on M. genitalium in general, and in particular on the JCVI strains.

 Read the full article

Eukaryotes can do phatocytosis due to their cytoskeleton by

Ciro Santilli 35  Updated 2025-01-10  +Created 1970-01-01

 View more

Power, Sex, Suicide by Nick Lane (2006) page 53 suggests that one tremendous advantage of eukaryotes over bacteria is their ability to change shape due to the presence of the cytoskeleton, and the lack of a rigid bacterial cell wall.

Imagine in a world where there are only bacteria, and you can eat entire bacteria in one go, what a huge advantage that is!

 Read the full article

 Pinned article: ourbigbook/introduction-to-the-ourbigbook-project

Welcome to the OurBigBook Project! Our goal is to create the perfect publishing platform for STEM subjects, and get university-level students to write the best free STEM tutorials ever.

Everyone is welcome to create an account and play with the site: ourbigbook.com/go/register. We belive that students themselves can write amazing tutorials, but teachers are welcome too. You can write about anything you want, it doesn't have to be STEM or even educational. Silly test content is very welcome and you won't be penalized in any way. Just keep it legal!

Video 1.

Intro to OurBigBook

. Source.

We have two killer features:

topics: topics group articles by different users with the same title, e.g. here is the topic for the "Fundamental Theorem of Calculus" ourbigbook.com/go/topic/fundamental-theorem-of-calculus
Articles of different users are sorted by upvote within each article page. This feature is a bit like:
- a Wikipedia where each user can have their own version of each article
- a Q&A website like Stack Overflow, where multiple people can give their views on a given topic, and the best ones are sorted by upvote. Except you don't need to wait for someone to ask first, and any topic goes, no matter how narrow or broad
This feature makes it possible for readers to find better explanations of any topic created by other writers. And it allows writers to create an explanation in a place that readers might actually find it.
Figure 1.
Screenshot of the "Derivative" topic page
. View it live at: ourbigbook.com/go/topic/derivative
Video 2.
OurBigBook Web topics demo
. Source.
local editing: you can store all your personal knowledge base content locally in a plaintext markup format that can be edited locally and published either:
- to OurBigBook.com to get awesome multi-user features like topics and likes
- as HTML files to a static website, which you can host yourself for free on many external providers like GitHub Pages, and remain in full control
This way you can be sure that even if OurBigBook.com were to go down one day (which we have no plans to do as it is quite cheap to host!), your content will still be perfectly readable as a static site.
Figure 2.
You can publish local OurBigBook lightweight markup files to either OurBigBook.com or as a static website
.
Figure 3.
Visual Studio Code extension installation
.
Figure 4.
Visual Studio Code extension tree navigation
.
Figure 5.
Web editor
. You can also edit articles on the Web editor without installing anything locally.
Video 3.
Edit locally and publish demo
. Source. This shows editing OurBigBook Markup and publishing it using the Visual Studio Code extension.
Video 4.
OurBigBook Visual Studio Code extension editing and navigation demo
. Source.
Internal cross file references done right:
Infinitely deep tables of contents:
Figure 6.
Dynamic article tree with infinitely deep table of contents
.
Live URL: ourbigbook.com/cirosantilli/chordate
Descendant pages can also show up as toplevel e.g.: ourbigbook.com/cirosantilli/chordate-subclade

All our software is open source and hosted at: github.com/ourbigbook/ourbigbook

Further documentation can be found at: docs.ourbigbook.com

Feel free to reach our to us for any help or suggestions: docs.ourbigbook.com/#contact

 Site settings