Asset Updated +Created
Commodity Updated +Created
Hewlett Packard Enterprise Updated +Created
Single-nucleotide polymorphism Updated +Created
E. Coli Whole Cell Model by Covert Lab / Source code overview Updated +Created
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
    "n" "CCO-BAC-NUCLEOID"
    "j" "CCO-CELL-PROJECTION"
    "w" "CCO-CW-BAC-NEG"
    "c" "CCO-CYTOSOL"
    "e" "CCO-EXTRACELLULAR"
    "m" "CCO-MEMBRANE"
    "o" "CCO-OUTER-MEM"
    "p" "CCO-PERI-BAC"
    "l" "CCO-PILUS"
    "i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
    148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
    [91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
    174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
    AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
    0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
    657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
    66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
    2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
    "HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    "L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
      {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
      {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
    "complexation"
      [
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
          "coeff": 1,
          "type": "proteincomplex",
          "location": "c",
          "form": "mature"
        },
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
          "coeff": -4,
          "type": "proteinmonomer",
          "location": "c",
          "form": "mature"
        }
      ]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
    "aspartate kinase / homoserine dehydrogenase"
    ""
    [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
    ["c"]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    "ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
    "arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
    "fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
    "dksA" "EG10230"
Feynman slash notation Updated +Created
Standard Generalized Markup Language Updated +Created
XML predecessor.
Sucrose Updated +Created
GNOME Display Manager Updated +Created
Hilbert's tenth problem Updated +Created
Once you hear about the uncomputability of such problems, it makes you see that all Diophantine equation questions risk being undecidable, though in some simpler cases we manage to come up with answers. The feeling is similar to watching people trying to solve the Halting problem, e.g. in the effort to determine BB(5).
Ciro Santilli's hardware / Park Tool BBT-22 Updated +Created
To remove and install Shimano and ISIS Drive splined 20-tooth bottom bracket cups.
Bought: 2020-11-07. Also getting a park Tool PAW-12 adjustable wrench to use with it.
DeepMind Updated +Created
They seem to do some cool stuff.
They have also declined every one of Ciro Santilli's applications for software engineer jobs before any interview. Ciro always wondered what does it take to get an interview with them. Lilely a PhD? Oh well.
In the early days at least lots of gamedev experience was enough though: www.linkedin.com/in/charles-beattie-0695373/.
Dirac adjoint Updated +Created
Cavendish experiment Updated +Created
Discrete logarithm of the cyclic group Updated +Created
This is the discrete logarithm problem where the group is a cyclic group.
In this case, the problem becomes equivalent to reversing modular exponentiation.
This computational problem forms the basis for Diffie-Hellman key exchange, because modular exponentiation can be efficiently computed, but no known way exists to efficiently compute the reverse function.
Drug lord Updated +Created
Misogyny Updated +Created
Id est Updated +Created
Science communication Updated +Created

Unlisted articles are being shown, click here to show only listed articles.