Visible spectrum Updated 2025-07-16
420 to 680 nm for sure, but larger ranges are observable in laboratory conditions.
Ultraviolet Updated 2025-07-16
X-ray Updated 2025-07-16
At 7e4cc9e57de76752df0f4e32eca95fb653ea64e4 you basically need to use the Docker image on Ubuntu 21.04 due to pip breaking changes... (not their fault). Perhaps pyenv would solve things, but who has the patience for that?!?!
The Docker setup from README does just work. The image download is a bit tedius, as it requires you to create a GitHub API key as described in the README, but there must be reasons for that.
Once the image is downloaded, you really want to run is from the root of the source tree:
sudo docker run --name=wcm -it -v "$(pwd):/wcEcoli" docker.pkg.github.com/covertlab/wholecellecolirelease/wcm-full
This mounts the host source under /wcEcoli, so you can easily edit and view output images from your host. Once inside Docker we can compile, run the simulation, and analyze results with:
make clean compile &&
python runscripts/manual/runFitter.py &&
python runscripts/manual/runSim.py &&
python runscripts/manual/analysisVariant.py &&
python runscripts/manual/analysisCohort.py &&
python runscripts/manual/analysisMultigen.py &&
python runscripts/manual/analysisSingle.py
The meaning of each of the analysis commands is described at Section "Output overview".
As a Docker refresher, after you stop the container, e.g. by restarting your computer or running sudo docker stop wcm, you can get back into it with:
sudo docker start wcm
sudo docker run -it wcm bash
runscripts/manual/runFitter.py takes about 15 minutes, and it generates files such as reconstruction/ecoli/dataclasses/process/two_component_system.py (related) which is required to run the simulation, it is basically a part of the build.
runSim.py does the main simulation, progress output contains lines of type:
Time (s)  Dry mass     Dry mass      Protein          RNA    Small mol     Expected
              (fg)  fold change  fold change  fold change  fold change  fold change
========  ========  ===========  ===========  ===========  ===========  ===========
    0.00    403.09        1.000        1.000        1.000        1.000        1.000
    0.20    403.18        1.000        1.000        1.000        1.000        1.000
and then it ended on the Lenovo ThinkPad P51 (2017) at:
 2569.18    783.09        1.943        1.910        2.005        1.950        1.963

Simulation finished:
 - Length: 0:42:49
 - Runtime: 0:09:13
when the cell had almost doubled, and presumably divided in 42 minutes of simulated time, which could make sense compared to the 20 under optimal conditions.
Run output is placed under out/:
Some of the output data is stored as .cpickle files. To observe those files, you need the original Python classes, and therefore you have to be inside Docker, from the host it won't work.
We can list all the plots that have been produced under out/ with
find -name '*.png'
Plots are also available in SVG and PDF formats, e.g.:
  • PNG: ./out/manual/plotOut/low_res_plots/massFractionSummary.png
  • SVG: ./out/manual/plotOut/svg_plots/massFractionSummary.svg The SVGs write text as polygons, see also: SVG fonts.
  • PDF: ./out/manual/plotOut/massFractionSummary.pdf
The output directory has a hierarchical structure of type:
./out/manual/wildtype_000000/000000/generation_000000/000000/
where:
  • wildtype_000000: variant conditions. wildtype is a human readable label, and 000000 is an index amongst the possible wildtype conditions. For example, we can have different simulations with different nutrients, or different DNA sequences. An example of this is shown at run variants.
  • 000000: initial random seed for the initial cell, likely fed to NumPy's np.random.seed
  • genereation_000000: this will increase with generations if we simulate multiple cells, which is supported by the model
  • 000000: this will presumably contain the cell index within a generation
We also understand that some of the top level directories contain summaries over all cells, e.g. the massFractionSummary.pdf plot exists at several levels of the hierarchy:
./out/manual/plotOut/massFractionSummary.pdf
./out/manual/wildtype_000000/plotOut/massFractionSummary.pdf
./out/manual/wildtype_000000/000000/plotOut/massFractionSummary.pdf
./out/manual/wildtype_000000/000000/generation_000000/000000/plotOut/massFractionSummary.pdf
Each of thoes four levels of plotOut is generated by a different one of the analysis scripts:
  • ./out/manual/plotOut: generated by python runscripts/manual/analysisVariant.py. Contains comparisons of different variant conditions. We confirm this by looking at the results of run variants.
  • ./out/manual/wildtype_000000/plotOut: generated by python runscripts/manual/analysisCohort.py --variant_index 0. TODO not sure how to differentiate between two different labels e.g. wildtype_000000 and somethingElse_000000. If -v is not given, a it just picks the first one alphabetically. TODO not sure how to automatically generate all of those plots without inspecting the directories.
  • ./out/manual/wildtype_000000/000000/plotOut: generated by python runscripts/manual/analysisMultigen.py --variant_index 0 --seed 0
  • ./out/manual/wildtype_000000/000000/generation_000000/000000/plotOut: generated by python runscripts/manual/analysisSingle.py --variant_index 0 --seed 0 --generation 0 --daughter 0. Contains information about a single specific cell.
It would be boring if we could only simulate the same condition all the time, so let's have a look at the different boundary conditions that we can apply to the cell!
We are able to alter things like the composition of the external medium, and the genome of the bacteria, which will make the bacteria behave differently.
The variant selection is a bit cumbersome as we have to use indexes instead of names, but one you know what you are doing, it is fine.
Of course, genetic modification is limited only to experimentally known protein interactions due to the intractability of computational protein folding and computational chemistry in general, solving those would bsai.
Besides time series run variants, conditions can also be selected directly without a time series as in:
python runscripts/manual/runSim.py --variant condition 1 1
which select row indices from reconstruction/ecoli/flat/condition/condition_defs.tsv. The above 1 1 would mean the second line of that file which starts with:
"condition" "nutrients" "genotype perturbations" "doubling time (units.min)" "active TFs"
"basal" "minimal" {} 44.0 []
"no_oxygen" "minimal_minus_oxygen" {} 100.0 []
"with_aa" "minimal_plus_amino_acids" {} 25.0 ["CPLX-125", "MONOMER0-162", "CPLX0-7671", "CPLX0-228", "MONOMER0-155"]
so 1 means no_oxygen.
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
    "n" "CCO-BAC-NUCLEOID"
    "j" "CCO-CELL-PROJECTION"
    "w" "CCO-CW-BAC-NEG"
    "c" "CCO-CYTOSOL"
    "e" "CCO-EXTRACELLULAR"
    "m" "CCO-MEMBRANE"
    "o" "CCO-OUTER-MEM"
    "p" "CCO-PERI-BAC"
    "l" "CCO-PILUS"
    "i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
    148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
    [91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
    174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
    AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
    0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
    657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
    66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
    2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
    "HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    "L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
      {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
      {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
    "complexation"
      [
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
          "coeff": 1,
          "type": "proteincomplex",
          "location": "c",
          "form": "mature"
        },
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
          "coeff": -4,
          "type": "proteinmonomer",
          "location": "c",
          "form": "mature"
        }
      ]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
    "aspartate kinase / homoserine dehydrogenase"
    ""
    [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
    ["c"]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    "ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
    "arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
    "fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
    "dksA" "EG10230"
Unfortunately, due to lack of one page to rule them all, the on-Git tree publication list is meager, some of the most relevant ones seems to be:
E. Coli K-12 MG1655 Updated 2025-07-16
NCBI taxonomy entry: www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=511145 This links to:
AlphaGo Updated 2025-07-16
AlphaZero Updated 2025-07-16
www.quora.com/Which-chess-engine-would-be-stronger-Alpha-Zero-or-Stockfish-12/answer/Felix-Zaslavskiy explains that it beat Stockfish 8. But then Stockfish was developed further and would start to beat it. We know this because although AlphaZero was closed source, they released the trained artificial neural network, so it was possible to replay AlphaZero at its particular stage of training.
Flatpak Updated 2025-07-16
Snap (package manager) Updated 2025-07-16
merlijn.sebrechts.be/blog/2020-08-02-why-one-snap-store/ has some very good comments on how snap is more closed than Flatpak.
Snap's permission system is extremely annoying, notably restricting access to home files. They need a popup that says "permission required by app, accept?" urgently!!!
CPT symmetry Updated 2025-09-17

There are unlisted articles, also show them or only show them.