Topics (119k) Articles (119k) Users (287) Discussions (237) Comments (383) Files (715) New article
New Updated Top Announced A-Z
Infrared by Ciro Santilli 40 Updated 2025-07-16
Read the full article
Visible spectrum by Ciro Santilli 40 Updated 2025-07-16
View more
420 to 680 nm for sure, but larger ranges are observable in laboratory conditions.
Read the full article
Ultraviolet by Ciro Santilli 40 Updated 2025-07-16
Read the full article
X-ray by Ciro Santilli 40 Updated 2025-07-16
Read the full article
E. Coli Whole Cell Model by Covert Lab / Install and first run by Ciro Santilli 40 Updated 2025-07-16
View more
At 7e4cc9e57de76752df0f4e32eca95fb653ea64e4 you basically need to use the Docker image on Ubuntu 21.04 due to pip breaking changes... (not their fault). Perhaps pyenv would solve things, but who has the patience for that?!?!
The Docker setup from README does just work. The image download is a bit tedius, as it requires you to create a GitHub API key as described in the README, but there must be reasons for that.
Once the image is downloaded, you really want to run is from the root of the source tree:
sudo docker run --name=wcm -it -v "$(pwd):/wcEcoli" docker.pkg.github.com/covertlab/wholecellecolirelease/wcm-full
This mounts the host source under /wcEcoli, so you can easily edit and view output images from your host. Once inside Docker we can compile, run the simulation, and analyze results with:
make clean compile &&
python runscripts/manual/runFitter.py &&
python runscripts/manual/runSim.py &&
python runscripts/manual/analysisVariant.py &&
python runscripts/manual/analysisCohort.py &&
python runscripts/manual/analysisMultigen.py &&
python runscripts/manual/analysisSingle.py
The meaning of each of the analysis commands is described at Section "Output overview".
As a Docker refresher, after you stop the container, e.g. by restarting your computer or running sudo docker stop wcm, you can get back into it with:
sudo docker start wcm
sudo docker run -it wcm bash
runscripts/manual/runFitter.py takes about 15 minutes, and it generates files such as reconstruction/ecoli/dataclasses/process/two_component_system.py (related) which is required to run the simulation, it is basically a part of the build.
runSim.py does the main simulation, progress output contains lines of type:
Time (s)  Dry mass     Dry mass      Protein          RNA    Small mol     Expected
              (fg)  fold change  fold change  fold change  fold change  fold change
========  ========  ===========  ===========  ===========  ===========  ===========
    0.00    403.09        1.000        1.000        1.000        1.000        1.000
    0.20    403.18        1.000        1.000        1.000        1.000        1.000
and then it ended on the Lenovo ThinkPad P51 (2017) at:
 2569.18    783.09        1.943        1.910        2.005        1.950        1.963

Simulation finished:
 - Length: 0:42:49
 - Runtime: 0:09:13
when the cell had almost doubled, and presumably divided in 42 minutes of simulated time, which could make sense compared to the 20 under optimal conditions.
Read the full article
E. Coli Whole Cell Model by Covert Lab / Output overview by Ciro Santilli 40 Updated 2025-07-16
View more
Run output is placed under out/:
Some of the output data is stored as .cpickle files. To observe those files, you need the original Python classes, and therefore you have to be inside Docker, from the host it won't work.
We can list all the plots that have been produced under out/ with
find -name '*.png'
Plots are also available in SVG and PDF formats, e.g.:
  • PNG: ./out/manual/plotOut/low_res_plots/massFractionSummary.png
  • SVG: ./out/manual/plotOut/svg_plots/massFractionSummary.svg The SVGs write text as polygons, see also: SVG fonts.
  • PDF: ./out/manual/plotOut/massFractionSummary.pdf
The output directory has a hierarchical structure of type:
./out/manual/wildtype_000000/000000/generation_000000/000000/
where:
  • wildtype_000000: variant conditions. wildtype is a human readable label, and 000000 is an index amongst the possible wildtype conditions. For example, we can have different simulations with different nutrients, or different DNA sequences. An example of this is shown at run variants.
  • 000000: initial random seed for the initial cell, likely fed to NumPy's np.random.seed
  • genereation_000000: this will increase with generations if we simulate multiple cells, which is supported by the model
  • 000000: this will presumably contain the cell index within a generation
We also understand that some of the top level directories contain summaries over all cells, e.g. the massFractionSummary.pdf plot exists at several levels of the hierarchy:
./out/manual/plotOut/massFractionSummary.pdf
./out/manual/wildtype_000000/plotOut/massFractionSummary.pdf
./out/manual/wildtype_000000/000000/plotOut/massFractionSummary.pdf
./out/manual/wildtype_000000/000000/generation_000000/000000/plotOut/massFractionSummary.pdf
Each of thoes four levels of plotOut is generated by a different one of the analysis scripts:
  • ./out/manual/plotOut: generated by python runscripts/manual/analysisVariant.py. Contains comparisons of different variant conditions. We confirm this by looking at the results of run variants.
  • ./out/manual/wildtype_000000/plotOut: generated by python runscripts/manual/analysisCohort.py --variant_index 0. TODO not sure how to differentiate between two different labels e.g. wildtype_000000 and somethingElse_000000. If -v is not given, a it just picks the first one alphabetically. TODO not sure how to automatically generate all of those plots without inspecting the directories.
  • ./out/manual/wildtype_000000/000000/plotOut: generated by python runscripts/manual/analysisMultigen.py --variant_index 0 --seed 0
  • ./out/manual/wildtype_000000/000000/generation_000000/000000/plotOut: generated by python runscripts/manual/analysisSingle.py --variant_index 0 --seed 0 --generation 0 --daughter 0. Contains information about a single specific cell.
Read the full article
E. Coli Whole Cell Model by Covert Lab / Run variants by Ciro Santilli 40 Updated 2025-07-16
View more
It would be boring if we could only simulate the same condition all the time, so let's have a look at the different boundary conditions that we can apply to the cell!
We are able to alter things like the composition of the external medium, and the genome of the bacteria, which will make the bacteria behave differently.
The variant selection is a bit cumbersome as we have to use indexes instead of names, but one you know what you are doing, it is fine.
Of course, genetic modification is limited only to experimentally known protein interactions due to the intractability of computational protein folding and computational chemistry in general, solving those would bsai.
Read the full article
E. Coli Whole Cell Model by Covert Lab / Other run variants by Ciro Santilli 40 Updated 2025-07-16
View more
Besides time series run variants, conditions can also be selected directly without a time series as in:
python runscripts/manual/runSim.py --variant condition 1 1
which select row indices from reconstruction/ecoli/flat/condition/condition_defs.tsv. The above 1 1 would mean the second line of that file which starts with:
"condition" "nutrients" "genotype perturbations" "doubling time (units.min)" "active TFs"
"basal" "minimal" {} 44.0 []
"no_oxygen" "minimal_minus_oxygen" {} 100.0 []
"with_aa" "minimal_plus_amino_acids" {} 25.0 ["CPLX-125", "MONOMER0-162", "CPLX0-7671", "CPLX0-228", "MONOMER0-155"]
so 1 means no_oxygen.
Read the full article
E. Coli Whole Cell Model by Covert Lab / Source code overview by Ciro Santilli 40 Updated 2025-07-16
View more
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
"n" "CCO-BAC-NUCLEOID"
"j" "CCO-CELL-PROJECTION"
"w" "CCO-CW-BAC-NEG"
"c" "CCO-CYTOSOL"
"e" "CCO-EXTRACELLULAR"
"m" "CCO-MEMBRANE"
"o" "CCO-OUTER-MEM"
"p" "CCO-PERI-BAC"
"l" "CCO-PILUS"
"i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
[91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
"HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
"L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"

"HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
  {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
  false
  ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]

"HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
  {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
  false
  ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
"complexation"
  [
    {
      "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
      "coeff": 1,
      "type": "proteincomplex",
      "location": "c",
      "form": "mature"
    },
    {
      "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
      "coeff": -4,
      "type": "proteinmonomer",
      "location": "c",
      "form": "mature"
    }
  ]
"ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
"aspartate kinase / homoserine dehydrogenase"
""
[0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
["c"]
"ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
"ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
"arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
"fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
"dksA" "EG10230"
Read the full article
E. Coli Whole Cell Model by Covert Lab / Model validation by Ciro Santilli 40 Updated 2025-07-16
View more
TODO compare with actual datasetes.
Read the full article
E. Coli Whole Cell Model by Covert Lab / Publications by Ciro Santilli 40 Updated 2025-07-16
View more
Unfortunately, due to lack of one page to rule them all, the on-Git tree publication list is meager, some of the most relevant ones seems to be:
Read the full article
E. Coli K-12 MG1655 by Ciro Santilli 40 Updated 2025-07-16
View more
NCBI taxonomy entry: www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=511145 This links to:
Read the full article
Mathematical, Physical and Life Sciences division of the University of Oxford by Ciro Santilli 40 Updated 2025-07-16
View more
Read the full article
AlphaGo by Ciro Santilli 40 Updated 2025-07-16
Read the full article
AlphaZero by Ciro Santilli 40 Updated 2025-07-16
View more
www.quora.com/Which-chess-engine-would-be-stronger-Alpha-Zero-or-Stockfish-12/answer/Felix-Zaslavskiy explains that it beat Stockfish 8. But then Stockfish was developed further and would start to beat it. We know this because although AlphaZero was closed source, they released the trained artificial neural network, so it was possible to replay AlphaZero at its particular stage of training.
Read the full article
David Tong's 2009 Quantum Field Theory lectures at the Perimeter Institute / Lecture 1 by Ciro Santilli 40 Updated 2025-07-16
View more
Read the full article
Flatpak by Ciro Santilli 40 Updated 2025-07-16
Read the full article
Snap (package manager) by Ciro Santilli 40 Updated 2025-07-16
View more
merlijn.sebrechts.be/blog/2020-08-02-why-one-snap-store/ has some very good comments on how snap is more closed than Flatpak.
Snap's permission system is extremely annoying, notably restricting access to home files. They need a popup that says "permission required by app, accept?" urgently!!!
Read the full article
CPT symmetry by Ciro Santilli 40 Updated 2025-09-17
Read the full article
Strong CP problem by Ciro Santilli 40 Updated 2025-07-16
Read the full article

Pinned article: Introduction to the OurBigBook Project

Welcome to the OurBigBook Project! Our goal is to create the perfect publishing platform for STEM subjects, and get university-level students to write the best free STEM tutorials ever.
Everyone is welcome to create an account and play with the site: ourbigbook.com/go/register. We belive that students themselves can write amazing tutorials, but teachers are welcome too. You can write about anything you want, it doesn't have to be STEM or even educational. Silly test content is very welcome and you won't be penalized in any way. Just keep it legal!
Video 1.
Intro to OurBigBook
. Source.
We have two killer features:
  1. topics: topics group articles by different users with the same title, e.g. here is the topic for the "Fundamental Theorem of Calculus" ourbigbook.com/go/topic/fundamental-theorem-of-calculus
    Articles of different users are sorted by upvote within each article page. This feature is a bit like:
    • a Wikipedia where each user can have their own version of each article
    • a Q&A website like Stack Overflow, where multiple people can give their views on a given topic, and the best ones are sorted by upvote. Except you don't need to wait for someone to ask first, and any topic goes, no matter how narrow or broad
    This feature makes it possible for readers to find better explanations of any topic created by other writers. And it allows writers to create an explanation in a place that readers might actually find it.
    Figure 1.
    Screenshot of the "Derivative" topic page
    . View it live at: ourbigbook.com/go/topic/derivative
    Video 2.
    OurBigBook Web topics demo
    . Source.
  2. local editing: you can store all your personal knowledge base content locally in a plaintext markup format that can be edited locally and published either:
    This way you can be sure that even if OurBigBook.com were to go down one day (which we have no plans to do as it is quite cheap to host!), your content will still be perfectly readable as a static site.
    Figure 2.
    You can publish local OurBigBook lightweight markup files to either OurBigBook.com or as a static website
    .
    Figure 3.
    Visual Studio Code extension installation
    .
    Figure 4.
    Visual Studio Code extension tree navigation
    .
    Figure 5.
    Web editor
    . You can also edit articles on the Web editor without installing anything locally.
    Video 3.
    Edit locally and publish demo
    . Source. This shows editing OurBigBook Markup and publishing it using the Visual Studio Code extension.
    Video 4.
    OurBigBook Visual Studio Code extension editing and navigation demo
    . Source.
  3. https://raw.githubusercontent.com/ourbigbook/ourbigbook-media/master/feature/x/hilbert-space-arrow.png
  4. Infinitely deep tables of contents:
    Figure 6.
    Dynamic article tree with infinitely deep table of contents
    .
    Descendant pages can also show up as toplevel e.g.: ourbigbook.com/cirosantilli/chordate-subclade
All our software is open source and hosted at: github.com/ourbigbook/ourbigbook
Further documentation can be found at: docs.ourbigbook.com
Feel free to reach our to us for any help or suggestions: docs.ourbigbook.com/#contact
Site settings