When you see it, you'll shit bricks by 
Ciro Santilli 35 Updated 2025-01-29 +Created 1970-01-01
Ciro Santilli 35 Updated 2025-01-29 +Created 1970-01-01Too many fun skit videos for Ciro Santilli's taste, but does have some serious derivations in quantum electrodynamics.
Original 1931 experiment by Raman and Bhagavantam: dspace.rri.res.in/bitstream/2289/2123/1/1931%20IJP%20V6%20p353.pdf
Fixed total angular momentum.
The direction however is not specified by this number.
To determine the quantum angular momentum, we need the magnetic quantum number, which then selects which orbital exactly we are talking about.
Initially there were mathematical reasons why people suspected that all boson needed to have 0 mass as is the case for photons a gluons, see Goldstone's theorem.
So people started theorizing some hack that would fix up the equations, and they came up with the higgs mechanism.
NCBI taxonomy entry: www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=511145 This links to:
- genome: www.ncbi.nlm.nih.gov/genome/?term=txid511145 From there there are links to either:
- Download the FASTA: "Download sequences in FASTA format for genome, protein"For the genome, you get a compressed FASTA file with extension
.fnacalledGCF_000005845.2_ASM584v2_genomic.fnathat starts with:>NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG
- Interactively browse the sequence on the browser viewer: "Reference genome: Escherichia coli str. K-12 substr. MG1655" which eventually leads to: www.ncbi.nlm.nih.gov/nuccore/556503834?report=graphIf we zoom into the start, we hover over the very first gene/protein: the famous (just kidding) e. Coli K-12 MG1655 gene thrL, at position 190-255.The second one is the much more interesting e. Coli K-12 MG1655 gene thrA.
- Gene list, with a total of 4,629 as of 2021: www.ncbi.nlm.nih.gov/gene/?term=txid511145
Real-time polymerase chain reaction by Ciro Santilli 35 Updated 2025-01-29 +Created 1970-01-01
Ciro Santilli 35 Updated 2025-01-29 +Created 1970-01-01Also known as: Quantitative PCR (qPCR).
Like PCR, but the amplification machine measures the concentration of DNA at each step.
This describes one possible concentration detection method with fluorescent molecules that only become fluorescent when the DNA is double stranded (SYBR Green)
Polymerase Chain Reaction (PCR) - Quantitative PCR (qPCR) by Applied Biological Materials (2016)
Source. This allows you to predict the exact initial concentration by extrapolating the exponential curve backwards.
TODO: vs non-real-time PCR. Why can't you just divide by 2 for every heating step to reach back the original concentration? Likely the reaction reach saturation at an unknown step.
TODO: vs non-real-time PCR in medical diagnostics: do you really need to know concentration for diagnostics? Isn't it enough to know if the virus is present or not?
Appears to be an unsolved physics problem. TODO why? Don't they all fit into the Standard Model already? So why is strong force less unified with electroweak, than electromagnetic + weak is unified in electroweak?
Buckyballs (C60) by Periodic Videos (2010)
Source. Actually shows them in a lab!- youtu.be/ljF5QhD5hnI?t=167 has a photo of the first effective production method, which passes a large current between two carbon rods
- youtu.be/ljF5QhD5hnI?t=245 and forward cuts (their editing is very annoying) shows how fullerene dissolves in an organic solvent TODO name, sounds like thodium? and produces a violet solution, while graphite doesn't. A Ultrasonic bath is needed for the solution to form however.
- youtu.be/ljF5QhD5hnI?t=501 fullerene is not a good lubricant despite being a little ball, because it is reactive and polymerises under pressure
Previously on EdX: www.edx.org/learn/quantum-physics-mechanics/delft-university-of-technology-topology-in-condensed-matter-tying-quantum-knots "DelftX: Topology in Condensed Matter: Tying Quantum Knots".
But then they regained their sanity and put the source code on GitHub: github.com/topocm/topocm_content and is CC BY-SA.
Pinned article: ourbigbook/introduction-to-the-ourbigbook-project
Welcome to the OurBigBook Project! Our goal is to create the perfect publishing platform for STEM subjects, and get university-level students to write the best free STEM tutorials ever.
Everyone is welcome to create an account and play with the site: ourbigbook.com/go/register. We belive that students themselves can write amazing tutorials, but teachers are welcome too. You can write about anything you want, it doesn't have to be STEM or even educational. Silly test content is very welcome and you won't be penalized in any way. Just keep it legal!
We have two killer features:
- topics: topics group articles by different users with the same title, e.g. here is the topic for the "Fundamental Theorem of Calculus" ourbigbook.com/go/topic/fundamental-theorem-of-calculusArticles of different users are sorted by upvote within each article page. This feature is a bit like:
- a Wikipedia where each user can have their own version of each article
- a Q&A website like Stack Overflow, where multiple people can give their views on a given topic, and the best ones are sorted by upvote. Except you don't need to wait for someone to ask first, and any topic goes, no matter how narrow or broad
This feature makes it possible for readers to find better explanations of any topic created by other writers. And it allows writers to create an explanation in a place that readers might actually find it.
Figure 1. Screenshot of the "Derivative" topic page. View it live at: ourbigbook.com/go/topic/derivative - local editing: you can store all your personal knowledge base content locally in a plaintext markup format that can be edited locally and published either:This way you can be sure that even if OurBigBook.com were to go down one day (which we have no plans to do as it is quite cheap to host!), your content will still be perfectly readable as a static site.
- to OurBigBook.com to get awesome multi-user features like topics and likes
- as HTML files to a static website, which you can host yourself for free on many external providers like GitHub Pages, and remain in full control
Figure 2. You can publish local OurBigBook lightweight markup files to either OurBigBook.com or as a static website.
Figure 3. Visual Studio Code extension installation.
Figure 4. Visual Studio Code extension tree navigation.
Figure 5. . You can also edit articles on the Web editor without installing anything locally. Video 3. Edit locally and publish demo. Source. This shows editing OurBigBook Markup and publishing it using the Visual Studio Code extension.Video 4. OurBigBook Visual Studio Code extension editing and navigation demo. Source. - Internal cross file references done right:
- Infinitely deep tables of contents:
Figure 6. Dynamic article tree with infinitely deep table of contents.Live URL: ourbigbook.com/cirosantilli/chordateDescendant pages can also show up as toplevel e.g.: ourbigbook.com/cirosantilli/chordate-subclade
All our software is open source and hosted at: github.com/ourbigbook/ourbigbook
Further documentation can be found at: docs.ourbigbook.com
Feel free to reach our to us for any help or suggestions: docs.ourbigbook.com/#contact