Ciro's Edict #7 / Issue tracker Updated 2025-07-16
Every article now has a (very basic) GitHub-like issue tracker. Comments now go under issues, and issues go under articles. Issues themselves are very similar to articles, with a title and a body.
This was part of 1.0, but not the first priority, but I did it now anyways because I'm trying to do all the database changes ASAP as I'm not in the mood to write database migrations.
Here's an example:
https://raw.githubusercontent.com/cirosantilli/media/master/OurBigBook_issue_list_on_article_page.png
SQLite Updated 2025-07-16
The minimalism, serverlessness/lack of temporary caches/lack of permission management, Hipp's religious obsession with efficiency, the use of their own pure Fossil version control[ref]. Wait, scrap that last one. Pure beauty!
Official Git mirror: github.com/sqlite/sqlite
Create a table
sqlite3 db.sqlite3 "
CREATE TABLE 'IntegerNames' (int0 INT, char0 CHAR(16));
INSERT INTO 'IntegerNames' (int0, char0) VALUES (2, 'two'), (3, 'three'), (5, 'five'), (7, 'seven');
"
List tables:
sqlite3 db.sqlite3 '.tables'
output:
IntegerNames
Show schema of a table:
sqlite3 db.sqlite3 '.schema IntegerNames'
outputs the query that would generate that table:
CREATE TABLE IF NOT EXISTS 'IntegerNames' (int0 INT, char0 CHAR(16));
Show all data in a table:
sqlite3 db.sqlite3 'SELECT * FROM IntegerNames'
output:
2|two
3|three
5|five
7|seven
Step busy beaver Updated 2025-07-16
The step busy beaver is a variant of the busy beaver game counts the number of steps before halt, instead of the number of 1's written to the tape.
As of 2023, it appears that BB(5) the same machine, , will win both for 5 states. But this is not always necessarily the case.
TODO clear attribution source:
Some people say, "Give the customers what they want." But that's not my approach. Our job is to figure out what they're going to want before they do. I think Henry Ford once said, "If I'd asked customers what they wanted, they would have told me, 'A faster horse!'" People don't know what they want until you show it to them. That's why I never rely on market research. Our task is to read things that are not yet on the page.
Stimulated emission Updated 2025-07-16
Photon hits excited electron, makes that electron go down, and generates a new identical photon in the process, with the exact same:This is the basis of lasers.
Lie algebra Updated 2025-07-16
Intuitively, a Lie algebra is a simpler object than a Lie group. Without any extra structure, groups can be very complicated non-linear objects. But a Lie algebra is just an algebra over a field, and one with a restricted bilinear map called the Lie bracket, that has to also be alternating and satisfy the Jacobi identity.
Another important way to think about Lie algebras, is as infinitesimal generators.
Because of the Lie group-Lie algebra correspondence, we know that there is almost a bijection between each Lie group and the corresponding Lie algebra. So it makes sense to try and study the algebra instead of the group itself whenever possible, to try and get insight and proofs in that simpler framework. This is the key reason why people study Lie algebras. One is philosophically reminded of how normal subgroups are a simpler representation of group homomorphisms.
To make things even simpler, because all vector spaces of the same dimension on a given field are isomorphic, the only things we need to specify a Lie group through a Lie algebra are:Note that the Lie bracket can look different under different basis of the Lie algebra however. This is shown for example at Physics from Symmetry by Jakob Schwichtenberg (2015) page 71 for the Lorentz group.
As mentioned at Lie Groups, Physics, and Geometry by Robert Gilmore (2008) Chapter 4 "Lie Algebras", taking the Lie algebra around the identity is mostly a convention, we could treat any other point, and things are more or less equivalent.
Lie algebra of Updated 2025-07-16
For every matrix in the set of all n-by-y square matrices , has inverse .
Note that this works even if is not invertible, and therefore not in !
Therefore, the Lie algebra of is the entire .
The project is written in Python, hurray!
But according to te README, it seems to be the use a code drop model with on-request access to master. Ciro Santilli asked at rationale on GitHub discussion, and they confirmed as expected that it is to:
  • to prevent their publication ideas from being stolen. Who would steal publication ideas with public proof in an issue tracker without crediting original authors? Academia is broken. Academia should be the most open form of knowledge sharing. But instead we get this silly competition for publication points.
  • to prevent noise from non-collaborators. But they only get like 2 issues as year on such a meganiche subject... Did you know that you can ignore people, and even block them if they are particularly annoying? Much more likely is that no one will every hear about your project and that it will die with its last graduate student slave.
The project is a followup to the earlier M. genitalium whole cell model by Covert lab which modelled Mycoplasma genitalium. E. Coli has 8x more genes (500 vs 4k), but it the undisputed bacterial model organism and as such has been studied much more thoroughly. It also reproduces faster than Mycoplasma (20 minutes vs a few hours), which is a huge advantages for validation/exploratory experiments.
The project has a partial dependency on the proprietary optimization software CPLEX which is freeware, for students, not sure what it is used for exactly, from the comment in the requirements.txt the dependency is only partial.
This project makes Ciro Santilli think of the E. Coli as an optimization problem. Given such external nutrient/temperature condition, which DNA sequence makes the cell grow the fastest? Balancing metabolites feels like designing a Factorio speedrun.
There is one major thing missing thing in the current model: promoters/transcription factor interactions are not modelled due to lack/low quality of experimental data: github.com/CovertLab/WholeCellEcoliRelease/issues/21. They just have a magic direct "transcription factor to gene" relationship, encoded at reconstruction/ecoli/flat/foldChanges.tsv in terms of type "if this is present, such protein is expressed 10x more". Transcription units are not implemented at all it appears.
Everything in this section refers to version 7e4cc9e57de76752df0f4e32eca95fb653ea64e4, the code drop from November 2020, and was tested on Ubuntu 21.04 with a docker install of docker.pkg.github.com/covertlab/wholecellecolirelease/wcm-full with image id 502c3e604265, unless otherwise noted.
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
    "n" "CCO-BAC-NUCLEOID"
    "j" "CCO-CELL-PROJECTION"
    "w" "CCO-CW-BAC-NEG"
    "c" "CCO-CYTOSOL"
    "e" "CCO-EXTRACELLULAR"
    "m" "CCO-MEMBRANE"
    "o" "CCO-OUTER-MEM"
    "p" "CCO-PERI-BAC"
    "l" "CCO-PILUS"
    "i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
    148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
    [91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
    174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
    AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
    0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
    657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
    66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
    2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
    "HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    "L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
      {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
      {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
    "complexation"
      [
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
          "coeff": 1,
          "type": "proteincomplex",
          "location": "c",
          "form": "mature"
        },
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
          "coeff": -4,
          "type": "proteinmonomer",
          "location": "c",
          "form": "mature"
        }
      ]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
    "aspartate kinase / homoserine dehydrogenase"
    ""
    [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
    ["c"]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    "ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
    "arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
    "fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
    "dksA" "EG10230"
Eightfold way (physics) Updated 2025-07-16
Video 1.
Strangeness Minus Three (BBC Horizon 1964)
Source. Basically shows Richard Feynman 15 minutes on a blackboard explaining the experimental basis of the eightfold way really well, while at the same time hyperactively moving all over. The word symmetry gets tossed a few times.
The Einstein summation convention works will with partial derivatives and it is widely used in particle physics.
In particular, the divergence and the Laplacian can be succinctly expressed in this notation:
In order to express partial derivatives, we must use what Ciro Santilli calls the "partial index partial derivative notation", which refers to variables with indices such as , , , , and instead of the usual letters , and .
Charging for certification is fine. Creating exams and preventing cheating has a cost.
Another thing that is fine charging for is dedicated 1-to-1 tutor time. This is something Udacity is doing as of 2022.
www.investopedia.com/articles/investing/042815/how-coursera-works-makes-money.asp has a good mention:
MOOCs were first created by people with utopian visions for the internet. This means the idea for platforms like Coursera was likely conceived without a business plan in mind. Nonetheless, Coursera has managed to monetize its platform. It is worth noting, however, that monetization has lead to the effective elimination of the original MOOC idea, which is predicated on ideals like free and open access, as well as the building of online communities.
Coursera users must pay to engage with the material in a meaningful way and take courses for individualistic purposes. This has been a consistent trend among all major online education platforms.
and it links to: www.freecodecamp.org/news/massive-open-online-courses-started-out-completely-free-but-where-are-they-now-1dd1020f59/, very good article!
That is a fundamental guiding principle of OurBigBook.com. The educational content must be licensed CC BY-SA!
Perhaps the most reliable way of reaching this state is E-learning websites must allow students to create learning content.
Bibliography:
Electronic component Updated 2025-07-16
Video 1.
Open Circuits book interview by CuriousMarc (2022)
Source.
Tinker Tailor Soldier Spy (TV series) Updated 2025-07-16
  • 1: Jim Prideaux captured. Some ex-colleague invites Smiley to dinner and keeps asking how incompetent people like Alleline climbed to the top of the Circus. Smiley recalled to service to meet Ricki Tarr.
  • 2: Ricki Tarr tells his story to Smiley. Peter Guillam starts stealing material from the Circus, find missing page on the communication officer list. Smiley sets up his investigation operation.
  • 3: Smiley meets Connie who tells that she was fired for suspecting Poliakov. Flashbacks show the ousting of Control and Smiley.
  • 4: Guillam steals more material from the circus. While doing that, he is called by the top officers to inquire about Ricki Tarr being in England, which they suspect because they discovered that his family has come.
  • 5: Jim Prideaux tells his story to Smiley, who cannot easily access the Circus reports about it. When he is returned to England, there was basically no debriefing, and Esterhase already knew about the Tinker Tailor codenames, presumably through Merlin.
  • 6: Smiley hears the story of yet another ousted man, who heard the Russians knew in advance about Jim Prideaux' coming. Toby Esterhase dismissed him for alcoholism.
United States Updated 2025-07-16
The ruler of the 1950-2020 world by Dollar and nuke count.
Capable of evil like any other country, and somewhat merciless to its poor and overly egocentric, but not nearly as evil as any dictatorship.
Has the huge advantage of being one large country which speaks English.
Countries of the world have only two choices as of 2019: either rally behind the US and support democracy, or rally behind China and support dictatorship. The choice is up to you, voters. The more you deal with China, the more you lose your democracy and freedom. All dictatorships have no doubt that they must stick together.
And Americans, please stop that America Number 1 bullshit. Obviously everyone has to strive to be the best, so when you say it like that, it sounds like "even if at the expense of everyone else". The motto has to be "democracy number 1" or else you will scare off all allies. If all other countries sell out to China, you are fucked.
Electroweak interaction Updated 2025-07-16
Video 1.
Electroweak Theory and the Origin of the Fundamental Forces by PBS Space Time (2020)
Source. Unsatisfactory, as usual.

There are unlisted articles, also show them or only show them.