E. Coli K-12 MG1655 gene thrA Updated 2025-07-16
Part of a reaction that produces threonine.
This protein is an enzyme. The UniProt entry clearly shows the chemical reactions that it catalyses. In this case, there are actually two! It can either transforming the metabolite:
  • "L-homoserine" into "L-aspartate 4-semialdehyde"
  • "L-aspartate" into "4-phospho-L-aspartate"
Also interestingly, we see that both of those reaction require some extra energy to catalyse, one needing adenosine triphosphate and the other nADP+.
TODO: any mention of how much faster it makes the reaction, numerically?
Since this is an enzyme, it would also be interesting to have a quick search for it in the KEGG entry starting from the organism: www.genome.jp/pathway/eco01100+M00022 We type in the search bar "thrA", it gives a long list, but the last entry is our "thrA". Selecting it highlights two pathways in the large graph, so we understand that it catalyzes two different reactions, as suggested by the protein name itself (fused blah blah). We can now hover over:
  • the edge: it shows all the enzymes that catalyze the given reaction. Both edges actually have multiple enzymes, e.g. the L-Homoserine path is also catalyzed by another enzyme called metL.
  • the node: they are the metabolites, e.g. one of the paths contains "L-homoserine" on one node and "L-aspartate 4-semialdehyde"
Note that common cofactor are omitted, since we've learnt from the UniProt entry that this reaction uses ATP.
If we can now click on the L-Homoserine edge, it takes us to: www.genome.jp/entry/eco:b0002+eco:b3940. Under "Pathway" we see an interesting looking pathway "Glycine, serine and threonine metabolism": www.genome.jp/pathway/eco00260+b0002 which contains a small manually selected and extremely clearly named subset of the larger graph!
But looking at the bottom of this subgraph (the UI is not great, can't Ctrl+F and enzyme names not shown, but the selected enzyme is slightly highlighted in red because it is in the URL www.genome.jp/pathway/eco00260+b0002 vs www.genome.jp/pathway/eco00260) we clearly see that thrA, thrB and thrC for a sequence that directly transforms "L-aspartate 4-semialdehyde" into "Homoserine" to "O-Phospho-L-homoserine" and finally tothreonine. This makes it crystal clear that they are not just located adjacently in the genome by chance: they are actually functionally related, and likely controlled by the same transcription factor: when you want one of them, you basically always want the three, because you must be are lacking threonine. TODO find transcription factor!
The UniProt entry also shows an interactive browser of the tertiary structure of the protein. We note that there are currently two sources available: X-ray crystallography and AlphaFold. To be honest, the AlphaFold one looks quite off!!!
By inspecting the FASTA for the entire genome, or by using the NCBI open reading frame tool, we see that this gene lies entirely in its own open reading frame, so it is quite boring
From the FASTA we see that the very first three Codons at position 337 are
ATG CGA GTG
where ATG is the start codon, and CGA GTG should be the first two that actually go into the protein:
ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER mentions that the enzime is most active as protein complex with four copies of the same protein:
Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
TODO image?
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
    "n" "CCO-BAC-NUCLEOID"
    "j" "CCO-CELL-PROJECTION"
    "w" "CCO-CW-BAC-NEG"
    "c" "CCO-CYTOSOL"
    "e" "CCO-EXTRACELLULAR"
    "m" "CCO-MEMBRANE"
    "o" "CCO-OUTER-MEM"
    "p" "CCO-PERI-BAC"
    "l" "CCO-PILUS"
    "i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
    148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
    [91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
    174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
    AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
    0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
    657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
    66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
    2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
    "HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    "L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
      {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
      {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
    "complexation"
      [
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
          "coeff": 1,
          "type": "proteincomplex",
          "location": "c",
          "form": "mature"
        },
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
          "coeff": -4,
          "type": "proteinmonomer",
          "location": "c",
          "form": "mature"
        }
      ]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
    "aspartate kinase / homoserine dehydrogenase"
    ""
    [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
    ["c"]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    "ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
    "arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
    "fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
    "dksA" "EG10230"
Enzyme Updated 2025-07-16
For an initial concrete example, consider e. Coli K-12 MG1655 gene thrA.
Video 1.
How Enzymes Work by RCSBProteinDataBank (2017)
Source. Shows in detail how aconitase catalyses the citrate to isocitrate reaction in the citric acid cycle.
Maxwell-Boltzmann vs Bose-Einstein vs Fermi-Dirac statistics Created 2024-10-28 Updated 2025-07-16
For example, Maxwell-Boltzmann statistics describes how the speeds of particles are distributed in an ideal gas.
The temperature of a gas is only a statistical average of the total energy of the gas. But at a given temperature, not all particles have the exact same speed as the average: some are higher and others lower than the average.
For a large number of particles however, the fraction of particles that will have a given speed at a given temperature is highly deterministic, and it is this that the distributions determine.
One of the main interest of learning those statistics is determining the probability, and therefore average speed, at which some event that requires a minimum energy to happen happens. For example, for a chemical reaction to happen, both input molecules need a certain speed to overcome the potential barrier of the reaction. Therefore, if we know how many particles have energy above some threshold, then we can estimate the speed of the reaction at a given temperature.
The three distributions can be summarized as:
A good conceptual starting point is to like the example that is mentioned at The Harvest of a Century by Siegmund Brandt (2008).
Consider a system with 2 particles and 3 states. Remember that:
Therefore, all the possible way to put those two particles in three states are for:
Molecular biology technologies Updated 2026-08-21
As of 2019, the silicon industry is ending, and molecular biology technology is one of the most promising and growing field of engineering.
Figure 1.
42 years of microprocessor trend data by Karl Rupp
. Source. Only transistor count increases, which also pushes core counts up. But what you gonna do when atomic limits are reached? The separation between two silicon atoms is 0.23nm and 2019 technology is at 5nm scale.
Such advances could one day lead to both biological super-AGI and immortality.
Ciro Santilli is especially excited about DNA-related technologies, because DNA is the centerpiece of biology, and it is programmable.
First, during the 2000's, the cost of DNA sequencing fell to about 1000 USD per genome in the end of the 2010's: Figure 2. "Cost per genome vs Moore's law from 2000 to 2019", largely due to "Illumina's" technology.
The medical consequences of this revolution are still trickling down towards medical applications of 2019, inevitably, but somewhat slowly due to tight privacy control of medical records.
Figure 2.
Cost per genome vs Moore's law from 2000 to 2019
. Source.
Ciro Santilli predicts that when the 100 dollar mark is reached, every person of the First world will have their genome sequenced, and then medical applications will be closer at hand than ever.
But even 100 dollars is not enough. Sequencing power is like computing power: humankind can never have enough. Sequencing is not a one per person thing. For example, as of 2019 tumors are already being sequenced to help understand and treat them, and scientists/doctors will sequence as many tumor cells as budget allows.
Then, in the 2010's, CRISPR/Cas9 gene editing started opening up the way to actually modifying the genome that we could now see through sequencing.
What's next?
Ciro believes that the next step in the revolution could be could be: de novo DNA synthesis.
This technology could be the key to the one of the ultimate dream of biologists: cheap programmable biology with push-button organism bootstrap!
Just imagine this: at the comfort of your own garage, you take some model organism of interest, maybe start humble with Escherichia coli. Then you modify its DNA to your liking, and upload it to a 3D printer sized machine on your workbench, which automatically synthesizes the DNA, and injects into a bootstrapped cell.
You then make experiments to check if the modified cell achieves your desired new properties, e.g. production of some protein, and if not reiterate, just like a software engineer.
Of course, even if we were able to do the bootstrap, the debugging process then becomes key, as visibility is the key limitation of biology, maybe we need other cheap technologies to come in at that point.
This a place point we see the beauty of evolution the brightest: evolution does not require observability. But it also implies that if your changes to the organism make it less fit, then your mutation will also likely be lost. This has to be one of the considerations done when designing your organism.
Other cool topic include:
It's weird, cells feel a lot like embedded systems: small, complex, hard to observe, and profound.
Ciro is sad that by the time he dies, humanity won't have understood the human brain, maybe not even a measly Escherichia coli... Heck, even key molecular biology events are not yet fully understood, see e.g. transcription regulation.
One of the most exciting aspects of molecular biology technologies is their relatively low entry cost, compared for example to other areas such as fusion energy and quantum computing.