James Howells Updated 2025-07-11 +Created 1970-01-01
View more
Read the full article
E. Coli Whole Cell Model by Covert Lab / Output overview Updated 2025-07-11 +Created 1970-01-01
View more
Run output is placed under out/:
Some of the output data is stored as .cpickle files. To observe those files, you need the original Python classes, and therefore you have to be inside Docker, from the host it won't work.
We can list all the plots that have been produced under out/ with
find -name '*.png'
Plots are also available in SVG and PDF formats, e.g.:
  • PNG: ./out/manual/plotOut/low_res_plots/massFractionSummary.png
  • SVG: ./out/manual/plotOut/svg_plots/massFractionSummary.svg The SVGs write text as polygons, see also: SVG fonts.
  • PDF: ./out/manual/plotOut/massFractionSummary.pdf
The output directory has a hierarchical structure of type:
./out/manual/wildtype_000000/000000/generation_000000/000000/
where:
  • wildtype_000000: variant conditions. wildtype is a human readable label, and 000000 is an index amongst the possible wildtype conditions. For example, we can have different simulations with different nutrients, or different DNA sequences. An example of this is shown at run variants.
  • 000000: initial random seed for the initial cell, likely fed to NumPy's np.random.seed
  • genereation_000000: this will increase with generations if we simulate multiple cells, which is supported by the model
  • 000000: this will presumably contain the cell index within a generation
We also understand that some of the top level directories contain summaries over all cells, e.g. the massFractionSummary.pdf plot exists at several levels of the hierarchy:
./out/manual/plotOut/massFractionSummary.pdf
./out/manual/wildtype_000000/plotOut/massFractionSummary.pdf
./out/manual/wildtype_000000/000000/plotOut/massFractionSummary.pdf
./out/manual/wildtype_000000/000000/generation_000000/000000/plotOut/massFractionSummary.pdf
Each of thoes four levels of plotOut is generated by a different one of the analysis scripts:
  • ./out/manual/plotOut: generated by python runscripts/manual/analysisVariant.py. Contains comparisons of different variant conditions. We confirm this by looking at the results of run variants.
  • ./out/manual/wildtype_000000/plotOut: generated by python runscripts/manual/analysisCohort.py --variant_index 0. TODO not sure how to differentiate between two different labels e.g. wildtype_000000 and somethingElse_000000. If -v is not given, a it just picks the first one alphabetically. TODO not sure how to automatically generate all of those plots without inspecting the directories.
  • ./out/manual/wildtype_000000/000000/plotOut: generated by python runscripts/manual/analysisMultigen.py --variant_index 0 --seed 0
  • ./out/manual/wildtype_000000/000000/generation_000000/000000/plotOut: generated by python runscripts/manual/analysisSingle.py --variant_index 0 --seed 0 --generation 0 --daughter 0. Contains information about a single specific cell.
Read the full article
E. Coli Whole Cell Model by Covert Lab / Source code overview Updated 2025-07-11 +Created 1970-01-01
View more
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
"n" "CCO-BAC-NUCLEOID"
"j" "CCO-CELL-PROJECTION"
"w" "CCO-CW-BAC-NEG"
"c" "CCO-CYTOSOL"
"e" "CCO-EXTRACELLULAR"
"m" "CCO-MEMBRANE"
"o" "CCO-OUTER-MEM"
"p" "CCO-PERI-BAC"
"l" "CCO-PILUS"
"i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
[91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
"HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
"L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"

"HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
  {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
  false
  ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]

"HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
  {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
  false
  ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
"complexation"
  [
    {
      "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
      "coeff": 1,
      "type": "proteincomplex",
      "location": "c",
      "form": "mature"
    },
    {
      "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
      "coeff": -4,
      "type": "proteinmonomer",
      "location": "c",
      "form": "mature"
    }
  ]
"ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
"aspartate kinase / homoserine dehydrogenase"
""
[0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
["c"]
"ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
"ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
"arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
"fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
"dksA" "EG10230"
Read the full article
Educational charitable organization Updated 2025-07-11 +Created 1970-01-01
View more
In this section we list charitable organizations that support education or research:
Read the full article
James Somers Updated 2025-07-11 +Created 1970-01-01
View more
Read the full article
Education as a system of indoctrination Updated 2025-07-11 +Created 1970-01-01
View more
Whenever Ciro Santilli walks in front of a school and sees the tall gates it makes him sad. Maybe 8 year olds need gates. But do we need to protect 15 year olds like that? Students should be going out to see the world, both good and evil not hiding from it! We should instead be guiding them to the world. But instead, we are locking them up in brainwashing centers.
Video "The Purpose of Education by Noam Chomsky (2012)" puts it well, education can be either be:
He has spoken about that infinitely, e.g. from when he was thin: www.youtube.com/watch?v=JVqMAlgAnlo
Bibliography:
Read the full article
Effect of a change of basis on the matrix of a bilinear form Updated 2025-07-11 +Created 1970-01-01
View more
If is the change of basis matrix, then the matrix representation of a bilinear form that looked like:
(1)
then the matrix in the new basis is:
(2)
Sylvester's law of inertia then tells us that the number of positive, negative and 0 eigenvalues of both of those matrices is the same.
Proof: the value of a given bilinear form cannot change due to a change of basis, since the bilinear form is just a function, and does not depend on the choice of basis. The only thing that change is the matrix representation of the form. Therefore, we must have:
(3)
and in the new basis:
(4)
and so since:
(5)
Read the full article
Eightfold way (physics) Updated 2025-07-11 +Created 1970-01-01
View more
Video 1.
Strangeness Minus Three (BBC Horizon 1964)
Source. Basically shows Richard Feynman 15 minutes on a blackboard explaining the experimental basis of the eightfold way really well, while at the same time hyperactively moving all over. The word symmetry gets tossed a few times.
Read the full article
Einstein notation for partial derivatives Updated 2025-07-11 +Created 1970-01-01
View more
The Einstein summation convention works will with partial derivatives and it is widely used in particle physics.
In particular, the divergence and the Laplacian can be succinctly expressed in this notation:
In order to express partial derivatives, we must use what Ciro Santilli calls the "partial index partial derivative notation", which refers to variables with indices such as , , , , and instead of the usual letters , and .
Read the full article
Einstein solid Updated 2025-07-11 +Created 1970-01-01
View more
One important quantum mechanics experiment, which using quantum effects explain the dependency of specific heat capacity on temperature, an effect which is not present in the Dulong-Petit law.
This is the solid-state analogue to the black-body radiation problem. It is also therefore a quantum mechanics-specific phenomenon.
Read the full article
E-learning Updated 2025-07-11 +Created 1970-01-01
View more
Read the full article
E-learning websites must keep content free, only charge for certification Updated 2025-07-11 +Created 1970-01-01
View more
Charging for certification is fine. Creating exams and preventing cheating has a cost.
Another thing that is fine charging for is dedicated 1-to-1 tutor time. This is something Udacity is doing as of 2022.
www.investopedia.com/articles/investing/042815/how-coursera-works-makes-money.asp has a good mention:
MOOCs were first created by people with utopian visions for the internet. This means the idea for platforms like Coursera was likely conceived without a business plan in mind. Nonetheless, Coursera has managed to monetize its platform. It is worth noting, however, that monetization has lead to the effective elimination of the original MOOC idea, which is predicated on ideals like free and open access, as well as the building of online communities.
Coursera users must pay to engage with the material in a meaningful way and take courses for individualistic purposes. This has been a consistent trend among all major online education platforms.
and it links to: www.freecodecamp.org/news/massive-open-online-courses-started-out-completely-free-but-where-are-they-now-1dd1020f59/, very good article!
That is a fundamental guiding principle of OurBigBook.com. The educational content must be licensed CC BY-SA!
Perhaps the most reliable way of reaching this state is E-learning websites must allow students to create learning content.
Bibliography:
Read the full article
Electrical impedance Updated 2025-07-11 +Created 1970-01-01
View more
It really allows you to do alternating current calculations much as you'd do DC calculations with resistors, quite poweful. It must have been all the rage in the 1950s.
Read the full article
Electromagnetism Updated 2025-07-11 +Created 1970-01-01
View more
As of the 20th century, this can be described well as "the phenomena described by Maxwell's equations".
Back through its history however, that was not at all clear. This highlights how big of an achievement Maxwell's equations are.
Read the full article
Electronic component Updated 2025-07-11 +Created 1970-01-01
View more
Video 1.
Open Circuits book interview by CuriousMarc (2022)
Source.
Read the full article
Electronic money Updated 2025-07-11 +Created 1970-01-01
View more
Our minimal definition of "electronic money" is the following.
Instead of creating legal tender such as Dollars as banknotes or transactions in some complex obscure banking system, the government offers an official simple centralized API that represents it instead.
Each citizen or legal entity has an account there, and transfers between registered users are just simple API calls.
So for example you would e able to put all your money in the government account instead of using useless banks. And then you would invest it as you want with the investment company of your choice, without tying the "my money is here" with "this is the best investment" aspects of banks.
Read the full article
Java (programming language) Updated 2025-07-11 +Created 1970-01-01
View more
Java is good.
Its boilerplate requirement is a pain, but the design is otherwise very clean.
But its ecosystem sucks.
The development process is rather closed, the issue tracker obscure.
And above all, Google LLC v. Oracle America, Inc. killed everybody's trust in it once and for all. Thanks Oracle.
Video 1.
Java for the Haters in 100 Seconds by Fireship (2022)
Source.
Read the full article
Electronic oscillator Updated 2025-07-11 +Created 1970-01-01
View more
Something where DC voltage comes in, and a periodic voltage comes out.
Video 1.
Oscillators: RC, LC, Crystal by GreatScott! (2015)
Source. Good video. Contains actual breadboard experiments on oscilloscope and circuit diagrams
Read the full article
JavaScript Updated 2025-07-11 +Created 1970-01-01
View more
The language all browsers converted to as of 2019, and therefore the easiest one to distribute and most widely implemented programming language.
Hopefully will be killed by WebAssembly one day.
Because JavaScript is a relatively crap/ad-hoc language, it ended up some decent tooling to make up for that, e.g. stuff like linting via ESLint and reformatting through Prettier is much more widespread than in other languages.
JavaScript data structure are also quite a bit anemic, which makes libraries such as lodash incredibly popular. But most of that stuff should be in the stdlib.
Our JavaScript examples can be found at:
Read the full article
JavaScript browser example Updated 2025-07-11 +Created 1970-01-01
View more
Read the full article

There are unlisted articles, also show them or only show them.