Hosted by Bill Nye.
Physics topics:
biology topics:
Genetics:
Medicine:
Nothing makes the fact that your life is an illusion clearer than animations of molecular biology processes. You just have no idea what is going on inside your own body right now!
And don't get Ciro Santilli started on the brain and the impossibility of free will.
And yet, we live, oblivious to all of it.
Video 1.
ATP synthase in action by HarvardX (2017)
Source.
Video 3.
The Inner Life of the Cell by XVIVO Scientific Animation (2011)
Source. Also created for BioVisions from Harvard University apparently like other amazing videos. It also has the best music.
Video 4.
DNA animations by wehi.tv for Science-Art exhibition by WEHImovies (2018)
Source.
Video 5. Source. Reupload by the MRC Laboratory of Molecular Biology, which was reuploaded from www.pbslearningmedia.org/resource/den08.sci.life.stru.dengue/dengue-virus-invades-a-cell/ which was reuploaded from wherever crazy place XVIVO put it.
A Structure for Deoxyribose Nucleic Acid Created 2025-06-12 Updated 2025-07-16
Starting line:
We wish to suggest a structure for the salt of deoxyribose nucleic acid (D.N.A,). This structure has novel features which are of considerable biological interest.
The Eighth Day of Creation explains the "salt" part as that was the usual way to prepare DNA for X-ray crystallography, where something binds with the phosphate groups of DNA
The paper then shoots down other previously devised helical structures, notably some containing 3 strands or phosphate on the inside.
Then they briefly describe their structure, and promise more details on future articles. This was mostly a short one-page priority note.
Then they drop their shell bomb conclusion:
It has not es~aped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.
Both Wilkins and Rosalind Franklin are acknowledged at the end.
DNA microarray Updated 2025-07-16
Can be seen as a cheap form of DNA sequencing that only test for a few hits. Some major applications:
The project is written in Python, hurray!
But according to te README, it seems to be the use a code drop model with on-request access to master. Ciro Santilli asked at rationale on GitHub discussion, and they confirmed as expected that it is to:
  • to prevent their publication ideas from being stolen. Who would steal publication ideas with public proof in an issue tracker without crediting original authors? Academia is broken. Academia should be the most open form of knowledge sharing. But instead we get this silly competition for publication points.
  • to prevent noise from non-collaborators. But they only get like 2 issues as year on such a meganiche subject... Did you know that you can ignore people, and even block them if they are particularly annoying? Much more likely is that no one will every hear about your project and that it will die with its last graduate student slave.
The project is a followup to the earlier M. genitalium whole cell model by Covert lab which modelled Mycoplasma genitalium. E. Coli has 8x more genes (500 vs 4k), but it the undisputed bacterial model organism and as such has been studied much more thoroughly. It also reproduces faster than Mycoplasma (20 minutes vs a few hours), which is a huge advantages for validation/exploratory experiments.
The project has a partial dependency on the proprietary optimization software CPLEX which is freeware, for students, not sure what it is used for exactly, from the comment in the requirements.txt the dependency is only partial.
This project makes Ciro Santilli think of the E. Coli as an optimization problem. Given such external nutrient/temperature condition, which DNA sequence makes the cell grow the fastest? Balancing metabolites feels like designing a Factorio speedrun.
There is one major thing missing thing in the current model: promoters/transcription factor interactions are not modelled due to lack/low quality of experimental data: github.com/CovertLab/WholeCellEcoliRelease/issues/21. They just have a magic direct "transcription factor to gene" relationship, encoded at reconstruction/ecoli/flat/foldChanges.tsv in terms of type "if this is present, such protein is expressed 10x more". Transcription units are not implemented at all it appears.
Everything in this section refers to version 7e4cc9e57de76752df0f4e32eca95fb653ea64e4, the code drop from November 2020, and was tested on Ubuntu 21.04 with a docker install of docker.pkg.github.com/covertlab/wholecellecolirelease/wcm-full with image id 502c3e604265, unless otherwise noted.
Let's look into a sample plot, out/manual/plotOut/svg_plots/massFractionSummary.svg, and try to understand as much as we can about what it means and how it was generated.
This plot contains how much of each type of mass is present in all cells. Since we simulated just one cell, it will be the same as the results for that cell.
We can see that all of them grow more or less linearly, perhaps as the start of an exponential. We can see that all of them grow more or less linearly, perhaps as the start of an exponential. We can see that all of them grow more or less linearly, perhaps as the start of an exponential.
By grepping the title "Cell mass fractions" in the source code, we see the files:
models/ecoli/analysis/cohort/massFractionSummary.py
models/ecoli/analysis/multigen/massFractionSummary.py
models/ecoli/analysis/variant/massFractionSummary.py
which must correspond to the different massFractionSummary plots throughout different levels of the hierarchy.
By reading models/ecoli/analysis/variant/massFractionSummary.py a little bit, we see that:
  • the plotting is done with Matplotlib, hurray
  • it is reading its data from files under ./out/manual/wildtype_000000/000000/generation_000000/000000/simOut/Mass/, more precisely ./out/manual/wildtype_000000/000000/generation_000000/000000/simOut/Mass/columns/<column-name>/data. They are binary files however.
    Looking at the source for wholecell/io/tablereader.py shows that those are just a standard NumPy serialization mechanism. Maybe they should have used the Hierarchical Data Format instead.
    We can also take this opportunity to try and find where the data is coming from. Mass from the ./out/manual/wildtype_000000/000000/generation_000000/000000/simOut/Mass/ looks like an ID, so we grep that and we reach models/ecoli/listeners/mass.py.
    From this we understand that all data that is to be saved from a simulation must be coming from listeners: likely nothing, or not much, is dumped by default, because otherwise it would take up too much disk space. You have to explicitly say what it is that you want to save via a listener that acts on each time step.
Figure 1.
Minimal condition mass fraction plot
. Source. File name: out/manual/plotOut/svg_plots/massFractionSummary.svg
More plot types will be explored at time series run variant, where we will contrast two runs with different growth mediums.
Run output is placed under out/:
Some of the output data is stored as .cpickle files. To observe those files, you need the original Python classes, and therefore you have to be inside Docker, from the host it won't work.
We can list all the plots that have been produced under out/ with
find -name '*.png'
Plots are also available in SVG and PDF formats, e.g.:
  • PNG: ./out/manual/plotOut/low_res_plots/massFractionSummary.png
  • SVG: ./out/manual/plotOut/svg_plots/massFractionSummary.svg The SVGs write text as polygons, see also: SVG fonts.
  • PDF: ./out/manual/plotOut/massFractionSummary.pdf
The output directory has a hierarchical structure of type:
./out/manual/wildtype_000000/000000/generation_000000/000000/
where:
  • wildtype_000000: variant conditions. wildtype is a human readable label, and 000000 is an index amongst the possible wildtype conditions. For example, we can have different simulations with different nutrients, or different DNA sequences. An example of this is shown at run variants.
  • 000000: initial random seed for the initial cell, likely fed to NumPy's np.random.seed
  • genereation_000000: this will increase with generations if we simulate multiple cells, which is supported by the model
  • 000000: this will presumably contain the cell index within a generation
We also understand that some of the top level directories contain summaries over all cells, e.g. the massFractionSummary.pdf plot exists at several levels of the hierarchy:
./out/manual/plotOut/massFractionSummary.pdf
./out/manual/wildtype_000000/plotOut/massFractionSummary.pdf
./out/manual/wildtype_000000/000000/plotOut/massFractionSummary.pdf
./out/manual/wildtype_000000/000000/generation_000000/000000/plotOut/massFractionSummary.pdf
Each of thoes four levels of plotOut is generated by a different one of the analysis scripts:
  • ./out/manual/plotOut: generated by python runscripts/manual/analysisVariant.py. Contains comparisons of different variant conditions. We confirm this by looking at the results of run variants.
  • ./out/manual/wildtype_000000/plotOut: generated by python runscripts/manual/analysisCohort.py --variant_index 0. TODO not sure how to differentiate between two different labels e.g. wildtype_000000 and somethingElse_000000. If -v is not given, a it just picks the first one alphabetically. TODO not sure how to automatically generate all of those plots without inspecting the directories.
  • ./out/manual/wildtype_000000/000000/plotOut: generated by python runscripts/manual/analysisMultigen.py --variant_index 0 --seed 0
  • ./out/manual/wildtype_000000/000000/generation_000000/000000/plotOut: generated by python runscripts/manual/analysisSingle.py --variant_index 0 --seed 0 --generation 0 --daughter 0. Contains information about a single specific cell.
The key model database is located in the source code at reconstruction/ecoli/flat.
Let's try to understand some interesting looking, with a special focus on our understanding of the tiny E. Coli K-12 MG1655 operon thrLABC part of the metabolism, which we have well understood at Section "E. Coli K-12 MG1655 operon thrLABC".
We'll realize that a lot of data and IDs come from/match BioCyc quite closely.
  • reconstruction/ecoli/flat/compartments.tsv contains cellular compartment information:
    "abbrev" "id"
    "n" "CCO-BAC-NUCLEOID"
    "j" "CCO-CELL-PROJECTION"
    "w" "CCO-CW-BAC-NEG"
    "c" "CCO-CYTOSOL"
    "e" "CCO-EXTRACELLULAR"
    "m" "CCO-MEMBRANE"
    "o" "CCO-OUTER-MEM"
    "p" "CCO-PERI-BAC"
    "l" "CCO-PILUS"
    "i" "CCO-PM-BAC-NEG"
  • reconstruction/ecoli/flat/promoters.tsv contains promoter information. Simple file, sample lines:
    "position" "direction" "id" "name"
    148 "+" "PM00249" "thrLp"
    corresponds to E. Coli K-12 MG1655 promoter thrLp, which starts as position 148.
  • reconstruction/ecoli/flat/proteins.tsv contains protein information. Sample line corresponding to e. Coli K-12 MG1655 gene thrA:
    "aaCount" "name" "seq" "comments" "codingRnaSeq" "mw" "location" "rnaId" "id" "geneId"
    [91, 46, 38, 44, 12, 53, 30, 63, 14, 46, 89, 34, 23, 30, 29, 51, 34, 4, 20, 0, 69] "ThrA" "MRVL..." "Location information from Ecocyc dump." "AUGCGAGUGUUG..." [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 89103.51099999998, 0.0, 0.0, 0.0, 0.0] ["c"] "EG10998_RNA" "ASPKINIHOMOSERDEHYDROGI-MONOMER" "EG10998"
    so we understand that:
  • reconstruction/ecoli/flat/rnas.tsv: TODO vs transcriptionUnits.tsv. Sample lines:
    "halfLife" "name" "seq" "type" "modifiedForms" "monomerId" "comments" "mw" "location" "ntCount" "id" "geneId" "microarray expression"
    174.0 "ThrA [RNA]" "AUGCGAGUGUUG..." "mRNA" [] "ASPKINIHOMOSERDEHYDROGI-MONOMER" "" [0.0, 0.0, 0.0, 0.0, 790935.00399999996, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0] ["c"] [553, 615, 692, 603] "EG10998_RNA" "EG10998" 0.0005264904
  • reconstruction/ecoli/flat/sequence.fasta: FASTA DNA sequence, first two lines:
    >E. coli K-12 MG1655 U00096.2 (1 to 4639675 = 4639675 bp)
    AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTG
  • reconstruction/ecoli/flat/transcriptionUnits.tsv: transcription units. We can observe for example the two different transcription units of the E. Coli K-12 MG1655 operon thrLABC in the lines:
    "expression_rate" "direction" "right" "terminator_id"  "name"    "promoter_id" "degradation_rate" "id"       "gene_id"                                   "left"
    0.0               "f"         310     ["TERM0-1059"]   "thrL"    "PM00249"     0.198905992329492 "TU0-42486" ["EG11277"]                                  148
    657.057317358791  "f"         5022    ["TERM_WC-2174"] "thrLABC" "PM00249"     0.231049060186648 "TU00178"   ["EG10998", "EG10999", "EG11000", "EG11277"] 148
  • reconstruction/ecoli/flat/genes.tsv
    "length" "name"                      "seq"             "rnaId"      "coordinate" "direction" "symbol" "type" "id"      "monomerId"
    66       "thr operon leader peptide" "ATGAAACGCATT..." "EG11277_RNA" 189         "+"         "thrL"   "mRNA" "EG11277" "EG11277-MONOMER"
    2463     "ThrA"                      "ATGCGAGTGTTG"    "EG10998_RNA" 336         "+"         "thrA"   "mRNA" "EG10998" "ASPKINIHOMOSERDEHYDROGI-MONOMER"
  • reconstruction/ecoli/flat/metabolites.tsv contains metabolite information. Sample lines:
    "id"                       "mw7.2" "location"
    "HOMO-SER"                 119.12  ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    "L-ASPARTATE-SEMIALDEHYDE" 117.104 ["n", "j", "w", "c", "e", "m", "o", "p", "l", "i"]
    In the case of the enzyme thrA, one of the two reactions it catalyzes is "L-aspartate 4-semialdehyde" into "Homoserine".
    Starting from the enzyme page: biocyc.org/gene?orgid=ECOLI&id=EG10998 we reach the reaction page: biocyc.org/ECOLI/NEW-IMAGE?type=REACTION&object=HOMOSERDEHYDROG-RXN which has reaction ID HOMOSERDEHYDROG-RXN, and that page which clarifies the IDs:
    so these are the compounds that we care about.
  • reconstruction/ecoli/flat/reactions.tsv contains chemical reaction information. Sample lines:
    "reaction id" "stoichiometry" "is reversible" "catalyzed by"
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NAD//L-ASPARTATE-SEMIALDEHYDE/NADH/PROTON.51."
      {"NADH[c]": -1, "PROTON[c]": -1, "HOMO-SER[c]": 1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "NAD[c]": 1}
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    
    "HOMOSERDEHYDROG-RXN-HOMO-SER/NADP//L-ASPARTATE-SEMIALDEHYDE/NADPH/PROTON.53."
      {"NADPH[c]": -1, "NADP[c]": 1, "PROTON[c]": -1, "L-ASPARTATE-SEMIALDEHYDE[c]": -1, "HOMO-SER[c]": 1
      false
      ["ASPKINIIHOMOSERDEHYDROGII-CPLX", "ASPKINIHOMOSERDEHYDROGI-CPLX"]
    • catalized by: here we see ASPKINIHOMOSERDEHYDROGI-CPLX, which we can guess is a protein complex made out of ASPKINIHOMOSERDEHYDROGI-MONOMER, which is the ID for the thrA we care about! This is confirmed in complexationReactions.tsv.
  • reconstruction/ecoli/flat/complexationReactions.tsv contains information about chemical reactions that produce protein complexes:
    "process" "stoichiometry" "id" "dir"
    "complexation"
      [
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-CPLX",
          "coeff": 1,
          "type": "proteincomplex",
          "location": "c",
          "form": "mature"
        },
        {
          "molecule": "ASPKINIHOMOSERDEHYDROGI-MONOMER",
          "coeff": -4,
          "type": "proteinmonomer",
          "location": "c",
          "form": "mature"
        }
      ]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    1
    The coeff is how many monomers need to get together for form the final complex. This can be seen from the Summary section of ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER:
    Aspartate kinase I / homoserine dehydrogenase I comprises a dimer of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
    Fantastic literature summary! Can't find that in database form there however.
  • reconstruction/ecoli/flat/proteinComplexes.tsv contains protein complex information:
    "name" "comments" "mw" "location" "reactionId" "id"
    "aspartate kinase / homoserine dehydrogenase"
    ""
    [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 356414.04399999994, 0.0, 0.0, 0.0, 0.0]
    ["c"]
    "ASPKINIHOMOSERDEHYDROGI-CPLX_RXN"
    "ASPKINIHOMOSERDEHYDROGI-CPLX"
  • reconstruction/ecoli/flat/protein_half_lives.tsv contains the half-life of proteins. Very few proteins are listed however for some reason.
  • reconstruction/ecoli/flat/tfIds.csv: transcription factors information:
    "TF"   "geneId"  "oneComponentId"  "twoComponentId" "nonMetaboliteBindingId" "activeId" "notes"
    "arcA" "EG10061" "PHOSPHO-ARCA"    "PHOSPHO-ARCA"
    "fnr"  "EG10325" "FNR-4FE-4S-CPLX" "FNR-4FE-4S-CPLX"
    "dksA" "EG10230"
Genetics Updated 2025-07-16
High level DNA studies? :-)
Whenever Ciro Santilli learns about molecular biology, he can't help but to feel that it feels like programming, and notably systems programming and computer hardware design.
In some sense, the comparison is obvious: DNA is clearly a programmable medium like any assembly language, but still, systems programming did give Ciro some further feelings.
Ciro likes to think that maybe that is why a hardcore systems programmer like Bert Hubert got into molecular biology.
Some other people who mention similar things:
Molecular biology technologies Updated 2025-07-16
As of 2019, the silicon industry is ending, and molecular biology technology is one of the most promising and growing field of engineering.
Figure 1.
42 years of microprocessor trend data by Karl Rupp
. Source. Only transistor count increases, which also pushes core counts up. But what you gonna do when atomic limits are reached? The separation between two silicon atoms is 0.23nm and 2019 technology is at 5nm scale.
Such advances could one day lead to both biological super-AGI and immortality.
Ciro Santilli is especially excited about DNA-related technologies, because DNA is the centerpiece of biology, and it is programmable.
First, during the 2000's, the cost of DNA sequencing fell to about 1000 USD per genome in the end of the 2010's: Figure 2. "Cost per genome vs Moore's law from 2000 to 2019", largely due to "Illumina's" technology.
The medical consequences of this revolution are still trickling down towards medical applications of 2019, inevitably, but somewhat slowly due to tight privacy control of medical records.
Figure 2.
Cost per genome vs Moore's law from 2000 to 2019
. Source.
Ciro Santilli predicts that when the 100 dollar mark is reached, every person of the First world will have their genome sequenced, and then medical applications will be closer at hand than ever.
But even 100 dollars is not enough. Sequencing power is like computing power: humankind can never have enough. Sequencing is not a one per person thing. For example, as of 2019 tumors are already being sequenced to help understand and treat them, and scientists/doctors will sequence as many tumor cells as budget allows.
Then, in the 2010's, CRISPR/Cas9 gene editing started opening up the way to actually modifying the genome that we could now see through sequencing.
What's next?
Ciro believes that the next step in the revolution could be could be: de novo DNA synthesis.
This technology could be the key to the one of the ultimate dream of biologists: cheap programmable biology with push-button organism bootstrap!
Just imagine this: at the comfort of your own garage, you take some model organism of interest, maybe start humble with Escherichia coli. Then you modify its DNA to your liking, and upload it to a 3D printer sized machine on your workbench, which automatically synthesizes the DNA, and injects into a bootstrapped cell.
You then make experiments to check if the modified cell achieves your desired new properties, e.g. production of some protein, and if not reiterate, just like a software engineer.
Of course, even if we were able to do the bootstrap, the debugging process then becomes key, as visibility is the key limitation of biology, maybe we need other cheap technologies to come in at that point.
This a place point we see the beauty of evolution the brightest: evolution does not require observability. But it also implies that if your changes to the organism make it less fit, then your mutation will also likely be lost. This has to be one of the considerations done when designing your organism.
Other cool topic include:
It's weird, cells feel a lot like embedded systems: small, complex, hard to observe, and profound.
Ciro is sad that by the time he dies, humanity won't have understood the human brain, maybe not even a measly Escherichia coli... Heck, even key molecular biology events are not yet fully understood, see e.g. transcription regulation.
One of the most exciting aspects of molecular biology technologies is their relatively low entry cost, compared for example to other areas such as fusion energy and quantum computing.
OpenWorm Updated 2025-07-16
High level simulation only, no way to get from DNA to worm! :-) Includes:
3D body viewer at: browser.openworm.org/ TODO can you click on a cell to get its name?
Video 1.
OpenWorm Sibernetic demo by Mike Vella (2013)
Source. Sibernetic adds a fluid dynamics solver for brain-in-the-loop simulation of C. elegans.
For those that know biology and just want to do the thing, see: Section "Protocols used".
The PuntSeq team uses an Oxford Nanopore MinION DNA sequencer made by Oxford Nanopore Technologies to sequence the 16S region of bacterial DNA, which is about 1500 nucleotides long.
This kind of "decode everything from the sample to see what species are present approach" is called "metagenomics".
This is how the MinION looks like: Figure 1. "Oxford Nanopore MinION top".
The 16S region codes for one of the RNA pieces that makes the bacterial ribosome.
Before sequencing the DNA, we will do a PCR with primers that fit just before and just after the 16S DNA, in well conserved regions expected to be present in all bacteria.
The PCR replicates only the DNA region between our two selected primers a gazillion times so that only those regions will actually get picked up by the sequencing step in practice.
Eukaryotes also have an analogous ribosome part, the 18S region, but the PCR primers are selected for targets around the 16S region which are only present in prokaryotes.
This way, we amplify only the 16S region of bacteria, excluding other parts of bacterial genome, and excluding eukaryotes entirely.
Despite coding such a fundamental piece of RNA, there is still surprisingly variability in the 16S region across different bacteria, and it is those differences will allow us to identify which bacteria are present in the river.
The variability exists because certain base pairs are not fundamental for the function of the 16S region. This variability happens mostly on RNA loops as opposed to stems, i.e. parts of the RNA that don't base pair with other RNA in the RNA secondary structure as shown at: Code 1. "RNA stem-loop structure".
                A-U
               /   \
A-U-C-G-A-U-C-G     C
| | | | | | | |     |
U-A-G-C-U-A-G-C     G
               \   /
                U-A
|             ||    |
+-------------++----+
    stem        loop
Code 1.
RNA stem-loop structure
.
This is how the 16S RNA secondary structure looks like in its full glory: Figure 5. "16S RNA secondary structure".
Since loops don't base pair, they are less crucial in the determination of the secondary structure of the RNA.
The variability is such that it is possible to identify individual species apart if full sequences are known with certainty.
With the experimental limitations of experiment however, we would only be able to obtain family or genus level breakdowns.
Physics and the illusion of life Updated 2025-12-13
They are a reminder that the lives that we live daily are mere illusions, religious concepts such as Maya and Samsara come to mind.
We as individuals perceive nothing about the materials that we touch every day really work, nor more importantly how our brain and cell work.
Everything is magic out of our control.
The natural sciences allow us peek, with huge concentrated effort, into tiny little bits a little of those unknowns, and blow our minds as we notice that we don't know anything.
For all practical purposes in life, there is a huge macro micro gap. We are only able to directly perceive and influence the macro events. And through those we try to affect micro events. Because for good or bad, micro events reflect in the macro world.
It is as if we live in a different plane of existence above molecules, and below galaxies. The hierarchy of Figure "xkcd 435: Fields arranged by purity" puts that nicely into perspective, shame it only starts at the economical level, not going up to astronomy.
The great beauty of science is that it allows us to puncture through some of the layers of reality, either up or down, away from our daily experience.
And the great beauty of artificial intelligence research is that it allows to peer deeper into exactly our layer of existence.
Every one or two weeks Ciro Santilli remembers that he and everything he touches are just a bunch of atoms, and that is an amazing feeling. This is Ciro's preferred source of Great doubt. Another concept that comes to mind is when you see it, you'll shit bricks.
Perhaps, the feeling of physics and the illusion of life reaches its peak in molecular biology.
Just look at your fucking hand right now.
Do you have any idea of each of the cells in it work? Isn't is at least 100 times more complex than the materials of the table you hand is currently resting on?
This is the non-science fiction version of the lotus-Eater Machine.
Alan Watts's "Philosopher" talk mentions related ideas:
The origin of a person who is defined as a philosopher, is one who finds that existence itself is exceedingly odd.
The toddler of a friend of Ciro Santilli's wife asked her mum:
Why doesn't my tiger doll close its eyes when we sleep?
Our perception of the macroscopic world is so magic that children have to learn the difference between living and non-living things.
James Somers put it very well as well in his article I should have loved biology by James Somers, this quote was brought to Ciro's attention by Bert Hubert's website[ref].
I should have loved biology but I found it to be a lifeless recitation of names: the Golgi apparatus and the Krebs cycle; mitosis, meiosis; DNA, RNA, mRNA, tRNA.
In the textbooks, astonishing facts were presented without astonishment. Someone probably told me that every cell in my body has the same DNA. But no one shook me by the shoulders, saying how crazy that was. I needed Lewis Thomas, who wrote in The Medusa and the Snail:
For the real amazement, if you wish to be amazed, is this process. You start out as a single cell derived from the coupling of a sperm and an egg; this divides in two, then four, then eight, and so on, and at a certain stage there emerges a single cell which has as all its progeny the human brain. The mere existence of such a cell should be one of the great astonishments of the earth. People ought to be walking around all day, all through their waking hours calling to each other in endless wonderment, talking of nothing except that cell.
The same applies to other natural sciences.
Video 1.
Alan Watts' "Philosopher" talk (1973)
Source. Lecture given at UCLA on 1973-02-21. Some key quotes from the talk:
The origin of a person who is defined as a philosopher, is one who finds that existence itself is exceedingly odd.
A transcript at: www.organism.earth/library/document/clarity-of-mind
Video 2.
Universe Size Comparison | Cosmic Eye
. Source.
Protein tag Updated 2025-07-16
You modify the DNA of a cell and stick a fluorescent protein right before or after another protein. Then when it gets translated, the GFP is stuck to the protein of interest, which hopefully hasn't lost its function as a result, then you can just see the protein of interest.